\
| Variant ID: vg1214622118 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 14622118 |
| Reference Allele: A | Alternative Allele: C,ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 120. )
ATTAAAATTCAAATTTGAAACAGGTATATAAACTTTTGGCTTATAAACTTTGGGTCTATAAACATTAGGTGTATAAACTTTAGATGTATAGAAATACTAT[A/C,ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC]
TATAAAAAATATTTGAATTCAAATTCAAATTTGAATTGGATATATAAACTTTTGACTTATAAACTTTAGATGTGTAAACTTGAGGTGTATAAACTTTAGG
CCTAAAGTTTATACACCTCAAGTTTACACATCTAAAGTTTATAAGTCAAAAGTTTATATATCCAATTCAAATTTGAATTTGAATTCAAATATTTTTTATA[T/G,GATAGTATTTCTATACATCTAAAGTTTATACACCTATGTTTATAGACCTAAAGTTTATAAGTCAAAAGTTTATATACCTGTTTCAAATTTGAATTTCAATTATATCCGATTTAAATTTGGATTCAAATATTTTTTATAT]
ATAGTATTTCTATACATCTAAAGTTTATACACCTAATGTTTATAGACCCAAAGTTTATAAGCCAAAAGTTTATATACCTGTTTCAAATTTGAATTTTAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 16.80% | 5.06% | 20.04% | ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.04% |
| All Indica | 2759 | 40.00% | 19.90% | 6.92% | 33.20% | NA |
| All Japonica | 1512 | 81.30% | 14.60% | 2.78% | 1.12% | ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.13% |
| Aus | 269 | 97.00% | 2.20% | 0.37% | 0.37% | NA |
| Indica I | 595 | 71.80% | 5.70% | 3.19% | 19.33% | NA |
| Indica II | 465 | 24.30% | 21.90% | 11.83% | 41.94% | NA |
| Indica III | 913 | 26.30% | 26.30% | 6.68% | 40.74% | NA |
| Indica Intermediate | 786 | 41.10% | 22.00% | 7.12% | 29.77% | NA |
| Temperate Japonica | 767 | 89.80% | 6.80% | 1.83% | 1.30% | ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.26% |
| Tropical Japonica | 504 | 71.20% | 24.20% | 4.37% | 0.20% | NA |
| Japonica Intermediate | 241 | 75.50% | 19.50% | 2.49% | 2.49% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 72.20% | 17.80% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214622118 | A -> C | LOC_Os12g25340.1 | downstream_gene_variant ; 4080.0bp to feature; MODIFIER | silent_mutation | Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1214622118 | A -> C | LOC_Os12g25340-LOC_Os12g25350 | intergenic_region ; MODIFIER | silent_mutation | Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1214622118 | A -> DEL | N | N | silent_mutation | Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1214622118 | A -> ATATAAAAAATATTTGAATCCAAATTTAAA TCGGATATAATTGAAATTCAAATTTGAAAC AGGTATATAAACTTTTGACTTATAAACTTT AGGTCTATAAACATAGGTGTATAAACTTTA GATGTATAGAAATACTATC | LOC_Os12g25340.1 | downstream_gene_variant ; 4081.0bp to feature; MODIFIER | silent_mutation | Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1214622118 | A -> ATATAAAAAATATTTGAATCCAAATTTAAA TCGGATATAATTGAAATTCAAATTTGAAAC AGGTATATAAACTTTTGACTTATAAACTTT AGGTCTATAAACATAGGTGTATAAACTTTA GATGTATAGAAATACTATC | LOC_Os12g25340-LOC_Os12g25350 | intergenic_region ; MODIFIER | silent_mutation | Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214622118 | NA | 1.08E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 4.33E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 7.29E-06 | 7.29E-06 | mr1325 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 8.16E-07 | 8.16E-07 | mr1326 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 6.72E-08 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 5.84E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 8.73E-08 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 9.89E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 6.79E-06 | 6.79E-06 | mr1209_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.55E-07 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 3.17E-06 | 3.17E-06 | mr1230_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 3.28E-08 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 7.25E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 9.55E-06 | 9.55E-06 | mr1283_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 2.17E-06 | NA | mr1289_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 8.69E-07 | 8.69E-07 | mr1299_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 1.25E-06 | 1.25E-06 | mr1326_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 3.02E-06 | 3.02E-06 | mr1345_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 2.38E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 5.17E-07 | 5.17E-07 | mr1406_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 1.46E-06 | 1.46E-06 | mr1407_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 6.17E-06 | 1.07E-07 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 7.73E-09 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 8.55E-07 | 8.54E-07 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 2.24E-08 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.24E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 2.17E-06 | 2.17E-06 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 8.19E-07 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 4.18E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 1.51E-06 | 1.51E-06 | mr1605_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 6.55E-08 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.08E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 2.44E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 4.78E-09 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 4.61E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 2.33E-06 | 2.33E-06 | mr1700_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 2.99E-06 | 5.11E-06 | mr1706_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 5.24E-06 | 5.24E-06 | mr1727_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 7.58E-06 | 7.58E-06 | mr1787_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 3.75E-08 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 2.61E-07 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 2.99E-07 | 2.99E-07 | mr1869_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 5.68E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 9.81E-07 | 9.81E-07 | mr1876_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 1.90E-06 | 1.43E-08 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 3.45E-06 | 3.45E-06 | mr1901_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.11E-06 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.92E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 2.06E-12 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | 1.11E-06 | 1.11E-06 | mr1921_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 1.05E-06 | mr1924_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214622118 | NA | 3.83E-08 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |