\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214622118:

Variant ID: vg1214622118 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 14622118
Reference Allele: AAlternative Allele: C,ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAAAATTCAAATTTGAAACAGGTATATAAACTTTTGGCTTATAAACTTTGGGTCTATAAACATTAGGTGTATAAACTTTAGATGTATAGAAATACTAT[A/C,ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC]
TATAAAAAATATTTGAATTCAAATTCAAATTTGAATTGGATATATAAACTTTTGACTTATAAACTTTAGATGTGTAAACTTGAGGTGTATAAACTTTAGG

Reverse complement sequence

CCTAAAGTTTATACACCTCAAGTTTACACATCTAAAGTTTATAAGTCAAAAGTTTATATATCCAATTCAAATTTGAATTTGAATTCAAATATTTTTTATA[T/G,GATAGTATTTCTATACATCTAAAGTTTATACACCTATGTTTATAGACCTAAAGTTTATAAGTCAAAAGTTTATATACCTGTTTCAAATTTGAATTTCAATTATATCCGATTTAAATTTGGATTCAAATATTTTTTATAT]
ATAGTATTTCTATACATCTAAAGTTTATACACCTAATGTTTATAGACCCAAAGTTTATAAGCCAAAAGTTTATATACCTGTTTCAAATTTGAATTTTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 16.80% 5.06% 20.04% ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.04%
All Indica  2759 40.00% 19.90% 6.92% 33.20% NA
All Japonica  1512 81.30% 14.60% 2.78% 1.12% ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.13%
Aus  269 97.00% 2.20% 0.37% 0.37% NA
Indica I  595 71.80% 5.70% 3.19% 19.33% NA
Indica II  465 24.30% 21.90% 11.83% 41.94% NA
Indica III  913 26.30% 26.30% 6.68% 40.74% NA
Indica Intermediate  786 41.10% 22.00% 7.12% 29.77% NA
Temperate Japonica  767 89.80% 6.80% 1.83% 1.30% ATATAAAAAATATTTGAATCCAAATTTAAATCGGATATAATTGAAATTCAAATTTGAAACAGGTATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACATAGGTGTATAAACTTTAGATGTATAGAAATACTATC: 0.26%
Tropical Japonica  504 71.20% 24.20% 4.37% 0.20% NA
Japonica Intermediate  241 75.50% 19.50% 2.49% 2.49% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 72.20% 17.80% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214622118 A -> C LOC_Os12g25340.1 downstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1214622118 A -> C LOC_Os12g25340-LOC_Os12g25350 intergenic_region ; MODIFIER silent_mutation Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1214622118 A -> DEL N N silent_mutation Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1214622118 A -> ATATAAAAAATATTTGAATCCAAATTTAAA TCGGATATAATTGAAATTCAAATTTGAAAC AGGTATATAAACTTTTGACTTATAAACTTT AGGTCTATAAACATAGGTGTATAAACTTTA GATGTATAGAAATACTATC LOC_Os12g25340.1 downstream_gene_variant ; 4081.0bp to feature; MODIFIER silent_mutation Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1214622118 A -> ATATAAAAAATATTTGAATCCAAATTTAAA TCGGATATAATTGAAATTCAAATTTGAAAC AGGTATATAAACTTTTGACTTATAAACTTT AGGTCTATAAACATAGGTGTATAAACTTTA GATGTATAGAAATACTATC LOC_Os12g25340-LOC_Os12g25350 intergenic_region ; MODIFIER silent_mutation Average:26.089; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214622118 NA 1.08E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 4.33E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 7.29E-06 7.29E-06 mr1325 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 8.16E-07 8.16E-07 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 6.72E-08 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 5.84E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 8.73E-08 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 9.89E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 6.79E-06 6.79E-06 mr1209_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.55E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 3.17E-06 3.17E-06 mr1230_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 3.28E-08 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 7.25E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 9.55E-06 9.55E-06 mr1283_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 2.17E-06 NA mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 8.69E-07 8.69E-07 mr1299_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 1.25E-06 1.25E-06 mr1326_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 3.02E-06 3.02E-06 mr1345_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 2.38E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 5.17E-07 5.17E-07 mr1406_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 1.46E-06 1.46E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 6.17E-06 1.07E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 7.73E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 8.55E-07 8.54E-07 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 2.24E-08 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.24E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 2.17E-06 2.17E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 8.19E-07 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 4.18E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 1.51E-06 1.51E-06 mr1605_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 6.55E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.08E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 2.44E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 4.78E-09 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 4.61E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 2.33E-06 2.33E-06 mr1700_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 2.99E-06 5.11E-06 mr1706_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 5.24E-06 5.24E-06 mr1727_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 7.58E-06 7.58E-06 mr1787_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 3.75E-08 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 2.61E-07 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 2.99E-07 2.99E-07 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 5.68E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 9.81E-07 9.81E-07 mr1876_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 1.90E-06 1.43E-08 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 3.45E-06 3.45E-06 mr1901_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.11E-06 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.92E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 2.06E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 1.11E-06 1.11E-06 mr1921_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 1.05E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214622118 NA 3.83E-08 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251