\
| Variant ID: vg1214610078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14610078 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 104. )
AGAGGTGCACAACTTAGTGATGGGAATAACCAATGAGTTTGGAAAAAAGAGGAAAGTTGGAAAGACAAAAAAGAAGAGCATGTCGAAGGAAAAAACAGAG[G/A]
AGCATGTGGAAAAACAAAAGACAAAAGAGAGGAGCATGTGGAAAAAGAAGTCAATATTTTGGAGACTACCATACTAGAAGGATCTTAAAGTTCGCCACTG
CAGTGGCGAACTTTAAGATCCTTCTAGTATGGTAGTCTCCAAAATATTGACTTCTTTTTCCACATGCTCCTCTCTTTTGTCTTTTGTTTTTCCACATGCT[C/T]
CTCTGTTTTTTCCTTCGACATGCTCTTCTTTTTTGTCTTTCCAACTTTCCTCTTTTTTCCAAACTCATTGGTTATTCCCATCACTAAGTTGTGCACCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 3.00% | 24.71% | 17.27% | NA |
| All Indica | 2759 | 41.00% | 2.60% | 30.59% | 25.81% | NA |
| All Japonica | 1512 | 71.40% | 4.20% | 18.65% | 5.82% | NA |
| Aus | 269 | 93.70% | 0.70% | 4.09% | 1.49% | NA |
| Indica I | 595 | 44.70% | 1.50% | 31.43% | 22.35% | NA |
| Indica II | 465 | 34.40% | 3.70% | 35.91% | 26.02% | NA |
| Indica III | 913 | 41.50% | 3.40% | 25.41% | 29.68% | NA |
| Indica Intermediate | 786 | 41.30% | 2.00% | 32.82% | 23.79% | NA |
| Temperate Japonica | 767 | 90.00% | 1.00% | 8.08% | 0.91% | NA |
| Tropical Japonica | 504 | 45.00% | 9.30% | 31.94% | 13.69% | NA |
| Japonica Intermediate | 241 | 67.20% | 3.30% | 24.48% | 4.98% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 9.38% | 7.29% | NA |
| Intermediate | 90 | 65.60% | 4.40% | 24.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214610078 | G -> DEL | N | N | silent_mutation | Average:25.068; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1214610078 | G -> A | LOC_Os12g25340.1 | upstream_gene_variant ; 4946.0bp to feature; MODIFIER | silent_mutation | Average:25.068; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1214610078 | G -> A | LOC_Os12g25330.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.068; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214610078 | NA | 1.32E-09 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 2.25E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 2.20E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 1.36E-10 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 3.76E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 7.43E-10 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 2.83E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 1.45E-14 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 1.10E-07 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 2.59E-14 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | NA | 1.53E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214610078 | 5.51E-07 | 6.23E-08 | mr1623_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |