Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214592931:

Variant ID: vg1214592931 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14592931
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGTATCAATGTGATGCCGTGCAATCCATGCATCGGACTTACCGATGTTTCTGGCGTGAACTAAAGCCAAGTGCTCCTCGATGTAAGGAGCTACCAAT[G/A]
AAGATTGTTGCAGAACCGTGAAATGGGCTTTACGGAATAAATTGTTGTCTACCGTCATTATTGCTTTCCTTCCGAGAGTTCCCTTTCCCCGTAGTCTCCC

Reverse complement sequence

GGGAGACTACGGGGAAAGGGAACTCTCGGAAGGAAAGCAATAATGACGGTAGACAACAATTTATTCCGTAAAGCCCATTTCACGGTTCTGCAACAATCTT[C/T]
ATTGGTAGCTCCTTACATCGAGGAGCACTTGGCTTTAGTTCACGCCAGAAACATCGGTAAGTCCGATGCATGGATTGCACGGCATCACATTGATACTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	38.40%	0.30%	0.00%	NA
All Indica	2759	45.30%	54.40%	0.36%	0.00%	NA
All Japonica	1512	81.50%	18.20%	0.26%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	82.00%	17.80%	0.17%	0.00%	NA
Indica II	465	36.30%	62.80%	0.86%	0.00%	NA
Indica III	913	25.60%	74.00%	0.33%	0.00%	NA
Indica Intermediate	786	45.50%	54.20%	0.25%	0.00%	NA
Temperate Japonica	767	90.50%	9.30%	0.26%	0.00%	NA
Tropical Japonica	504	70.40%	29.40%	0.20%	0.00%	NA
Japonica Intermediate	241	76.30%	23.20%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214592931	G -> A	LOC_Os12g25320.1	missense_variant ; p.Ser547Leu; MODERATE	nonsynonymous_codon ; S547L	Average:22.899; most accessible tissue: Zhenshan97 flag leaf, score: 33.231	unknown	unknown	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214592931	NA	8.59E-08	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	6.31E-06	6.32E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	2.67E-06	2.67E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	4.91E-06	4.91E-06	mr1477	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	4.21E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	2.99E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	5.75E-06	5.75E-06	mr1690	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	7.08E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	4.81E-06	4.81E-06	mr1326_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	1.36E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	2.06E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	1.68E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	2.80E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	9.84E-08	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	3.30E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	1.07E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	3.52E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	5.51E-07	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214592931	NA	3.30E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251