\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214590110:

Variant ID: vg1214590110 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14590110
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATATTGTATTAAAACTCTAACTATAATGCTAAGTCTAAGTGTCATATATTAAATCTAATAGTCTTAATTGCATTAAAAATATAACAATCATATATATA[T/A]
TTACGTCACTTGCCTACGCGAATTCCTTCGAGGGCTAGCTACCACTCCGGCTTGAGGGACGACGACGATAACGTCTTTTCTGCAACATACAAAAAGATGT

Reverse complement sequence

ACATCTTTTTGTATGTTGCAGAAAAGACGTTATCGTCGTCGTCCCTCAAGCCGGAGTGGTAGCTAGCCCTCGAAGGAATTCGCGTAGGCAAGTGACGTAA[A/T]
TATATATATGATTGTTATATTTTTAATGCAATTAAGACTATTAGATTTAATATATGACACTTAGACTTAGCATTATAGTTAGAGTTTTAATACAATATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 4.50% 4.57% 52.75% NA
All Indica  2759 34.30% 7.60% 6.89% 51.18% NA
All Japonica  1512 53.30% 0.10% 0.66% 45.97% NA
Aus  269 2.20% 0.40% 2.60% 94.80% NA
Indica I  595 71.40% 1.30% 1.85% 25.38% NA
Indica II  465 13.30% 9.50% 6.24% 70.97% NA
Indica III  913 20.80% 11.10% 11.39% 56.74% NA
Indica Intermediate  786 34.20% 7.40% 5.85% 52.54% NA
Temperate Japonica  767 82.70% 0.00% 0.39% 16.95% NA
Tropical Japonica  504 16.50% 0.20% 0.60% 82.74% NA
Japonica Intermediate  241 36.90% 0.00% 1.66% 61.41% NA
VI/Aromatic  96 6.20% 0.00% 5.21% 88.54% NA
Intermediate  90 43.30% 1.10% 4.44% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214590110 T -> DEL N N silent_mutation Average:9.305; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg1214590110 T -> A LOC_Os12g25320.1 intron_variant ; MODIFIER silent_mutation Average:9.305; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214590110 3.70E-07 3.70E-07 mr1325 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 1.04E-07 1.04E-07 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 1.36E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 1.60E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 6.59E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 9.69E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 1.99E-06 1.99E-06 mr1325_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 1.19E-07 1.19E-07 mr1326_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 1.56E-06 1.56E-06 mr1333_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 1.47E-06 1.27E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 1.67E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 1.92E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 6.24E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 6.64E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 2.80E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 2.61E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 1.51E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 6.56E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 5.84E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214590110 NA 2.42E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251