Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214578422:

Variant ID: vg1214578422 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14578422
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATTCAAAGCAGTGCACCGTTCCCGGATCATAATCACCCCCTTATAAATAATGTATGGACTCCCCAGCTACCCCCGTGGGCTTATCTCCGCCACTTCA[C/T]
AGTCTGGTGCTCTACTATGAACCATACTATACAGAAAGTAAAGCCGTTGCCCACGCTGGCTTGTGGCTGGCATGGTAAATGTTTCACAACCGAAAATCGT

Reverse complement sequence

ACGATTTTCGGTTGTGAAACATTTACCATGCCAGCCACAAGCCAGCGTGGGCAACGGCTTTACTTTCTGTATAGTATGGTTCATAGTAGAGCACCAGACT[G/A]
TGAAGTGGCGGAGATAAGCCCACGGGGGTAGCTGGGGAGTCCATACATTATTTATAAGGGGGTGATTATGATCCGGGAACGGTGCACTGCTTTGAATTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	43.90%	3.70%	1.40%	NA
All Indica	2759	63.40%	35.80%	0.69%	0.11%	NA
All Japonica	1512	21.30%	65.90%	8.66%	4.17%	NA
Aus	269	80.30%	12.30%	7.43%	0.00%	NA
Indica I	595	30.40%	69.60%	0.00%	0.00%	NA
Indica II	465	76.60%	20.40%	2.37%	0.65%	NA
Indica III	913	77.50%	22.10%	0.33%	0.00%	NA
Indica Intermediate	786	64.20%	35.10%	0.64%	0.00%	NA
Temperate Japonica	767	10.60%	83.60%	4.95%	0.91%	NA
Tropical Japonica	504	32.10%	46.00%	12.70%	9.13%	NA
Japonica Intermediate	241	32.80%	51.00%	12.03%	4.15%	NA
VI/Aromatic	96	84.40%	13.50%	2.08%	0.00%	NA
Intermediate	90	45.60%	51.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214578422	C -> DEL	N	N	silent_mutation	Average:13.559; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1214578422	C -> T	LOC_Os12g25310.1	upstream_gene_variant ; 2817.0bp to feature; MODIFIER	silent_mutation	Average:13.559; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1214578422	C -> T	LOC_Os12g25300-LOC_Os12g25310	intergenic_region ; MODIFIER	silent_mutation	Average:13.559; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214578422	NA	1.99E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	4.39E-06	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	4.99E-06	4.99E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	6.16E-06	mr1616	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	5.51E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	9.24E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	5.93E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	1.34E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	7.13E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	9.59E-06	9.59E-06	mr1326_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	1.16E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	1.90E-06	1.90E-06	mr1406_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	4.22E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	2.09E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	2.17E-06	6.01E-09	mr1578_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	3.21E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	6.89E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	1.77E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	5.38E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	3.95E-06	NA	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	1.37E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	9.61E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	2.03E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	5.44E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214578422	NA	2.80E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251