\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214569460:

Variant ID: vg1214569460 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14569460
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGACGCTAGGTCCGTTTGAAGTCAGTGCTGTCTCCGGAGGCCGAACTGGACTTGGACTTGGAATTATCATTGGAACATGTGAAGTTATGAGCGTATCC[G/A]
ACGAAGTGATGTCCTCATTAATATGTGTGCCACATGCTATACTTGTGGTATCTATGCTTGGTGCCCTCTAGGGAAACAAAGAGAAGATTGATATCATGCA

Reverse complement sequence

TGCATGATATCAATCTTCTCTTTGTTTCCCTAGAGGGCACCAAGCATAGATACCACAAGTATAGCATGTGGCACACATATTAATGAGGACATCACTTCGT[C/T]
GGATACGCTCATAACTTCACATGTTCCAATGATAATTCCAAGTCCAAGTCCAGTTCGGCCTCCGGAGACAGCACTGACTTCAAACGGACCTAGCGTCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 44.70% 1.10% 0.57% NA
All Indica  2759 42.90% 54.70% 1.52% 0.91% NA
All Japonica  1512 80.60% 18.90% 0.40% 0.07% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 80.80% 19.00% 0.17% 0.00% NA
Indica II  465 35.30% 62.60% 1.29% 0.86% NA
Indica III  913 23.30% 71.60% 3.07% 1.97% NA
Indica Intermediate  786 41.50% 57.30% 0.89% 0.38% NA
Temperate Japonica  767 90.20% 9.30% 0.39% 0.13% NA
Tropical Japonica  504 69.60% 30.20% 0.20% 0.00% NA
Japonica Intermediate  241 73.00% 26.10% 0.83% 0.00% NA
VI/Aromatic  96 24.00% 72.90% 2.08% 1.04% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214569460 G -> DEL N N silent_mutation Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1214569460 G -> A LOC_Os12g25300.1 downstream_gene_variant ; 952.0bp to feature; MODIFIER silent_mutation Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1214569460 G -> A LOC_Os12g25300-LOC_Os12g25310 intergenic_region ; MODIFIER silent_mutation Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214569460 NA 1.16E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 5.15E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 9.43E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 4.58E-06 4.58E-06 mr1325 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 6.26E-07 6.26E-07 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 5.93E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 1.62E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 8.76E-10 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 1.24E-06 4.88E-07 mr1030_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 8.17E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 2.90E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 5.71E-06 NA mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 8.40E-06 NA mr1331_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 1.58E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 1.05E-07 2.94E-08 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 3.77E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 9.99E-07 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 6.32E-06 1.43E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 5.70E-07 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 8.21E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 2.58E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 9.48E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 1.46E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 2.42E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460 NA 9.74E-08 mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251