Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214569460:

Variant ID: vg1214569460 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14569460
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGACGCTAGGTCCGTTTGAAGTCAGTGCTGTCTCCGGAGGCCGAACTGGACTTGGACTTGGAATTATCATTGGAACATGTGAAGTTATGAGCGTATCC[G/A]
ACGAAGTGATGTCCTCATTAATATGTGTGCCACATGCTATACTTGTGGTATCTATGCTTGGTGCCCTCTAGGGAAACAAAGAGAAGATTGATATCATGCA

Reverse complement sequence

TGCATGATATCAATCTTCTCTTTGTTTCCCTAGAGGGCACCAAGCATAGATACCACAAGTATAGCATGTGGCACACATATTAATGAGGACATCACTTCGT[C/T]
GGATACGCTCATAACTTCACATGTTCCAATGATAATTCCAAGTCCAAGTCCAGTTCGGCCTCCGGAGACAGCACTGACTTCAAACGGACCTAGCGTCTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	44.70%	1.10%	0.57%	NA
All Indica	2759	42.90%	54.70%	1.52%	0.91%	NA
All Japonica	1512	80.60%	18.90%	0.40%	0.07%	NA
Aus	269	20.80%	79.20%	0.00%	0.00%	NA
Indica I	595	80.80%	19.00%	0.17%	0.00%	NA
Indica II	465	35.30%	62.60%	1.29%	0.86%	NA
Indica III	913	23.30%	71.60%	3.07%	1.97%	NA
Indica Intermediate	786	41.50%	57.30%	0.89%	0.38%	NA
Temperate Japonica	767	90.20%	9.30%	0.39%	0.13%	NA
Tropical Japonica	504	69.60%	30.20%	0.20%	0.00%	NA
Japonica Intermediate	241	73.00%	26.10%	0.83%	0.00%	NA
VI/Aromatic	96	24.00%	72.90%	2.08%	1.04%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214569460	G -> DEL	N	N	silent_mutation	Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1214569460	G -> A	LOC_Os12g25300.1	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1214569460	G -> A	LOC_Os12g25300-LOC_Os12g25310	intergenic_region ; MODIFIER	silent_mutation	Average:27.022; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214569460	NA	1.16E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	5.15E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	9.43E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	4.58E-06	4.58E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	6.26E-07	6.26E-07	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	5.93E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	1.62E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	8.76E-10	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	1.24E-06	4.88E-07	mr1030_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	8.17E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	2.90E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	5.71E-06	NA	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	8.40E-06	NA	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	1.58E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	1.05E-07	2.94E-08	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	3.77E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	9.99E-07	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	6.32E-06	1.43E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	5.70E-07	mr1578_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	8.21E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	2.58E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	9.48E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	1.46E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	2.42E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569460	NA	9.74E-08	mr1965_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251