Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214569048:

Variant ID: vg1214569048 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14569048
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGATTGAAGTGGTAGATCTAATCGACCCGGCAAATCAACACACCAACTATTGGGGGCTCTGAATCTAAAGTCGCCGACTAATCGAACGAGAACTAGAG[A/G,T]
TAAGGTAAATGGCACTTGGCAAAATTCAACTAAACAAAACCCAATTGTTTTTGAGGATGTACAAAGCTATTTATAGAGGAAAATAAAGCTAGGGTTAAGT

Reverse complement sequence

ACTTAACCCTAGCTTTATTTTCCTCTATAAATAGCTTTGTACATCCTCAAAAACAATTGGGTTTTGTTTAGTTGAATTTTGCCAAGTGCCATTTACCTTA[T/C,A]
CTCTAGTTCTCGTTCGATTAGTCGGCGACTTTAGATTCAGAGCCCCCAATAGTTGGTGTGTTGATTTGCCGGGTCGATTAGATCTACCACTTCAATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	44.80%	1.35%	0.40%	NA
All Indica	2759	42.70%	54.50%	2.07%	0.65%	NA
All Japonica	1512	80.50%	19.10%	0.33%	0.07%	NA
Aus	269	20.80%	78.80%	0.37%	0.00%	NA
Indica I	595	80.70%	18.00%	1.18%	0.17%	NA
Indica II	465	35.30%	62.80%	1.72%	0.22%	NA
Indica III	913	22.90%	72.50%	2.96%	1.64%	NA
Indica Intermediate	786	41.50%	56.50%	1.91%	0.13%	NA
Temperate Japonica	767	90.20%	9.30%	0.39%	0.13%	NA
Tropical Japonica	504	69.80%	30.20%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	27.40%	0.83%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214569048	A -> DEL	N	N	silent_mutation	Average:30.616; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1214569048	A -> G	LOC_Os12g25300.1	downstream_gene_variant ; 540.0bp to feature; MODIFIER	silent_mutation	Average:30.616; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1214569048	A -> G	LOC_Os12g25300-LOC_Os12g25310	intergenic_region ; MODIFIER	silent_mutation	Average:30.616; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1214569048	A -> T	LOC_Os12g25300.1	downstream_gene_variant ; 540.0bp to feature; MODIFIER	N	Average:30.616; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1214569048	A -> T	LOC_Os12g25300-LOC_Os12g25310	intergenic_region ; MODIFIER	N	Average:30.616; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214569048	NA	1.51E-10	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	7.21E-06	7.21E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	8.70E-06	8.70E-06	mr1690	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	9.68E-06	mr1725	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	4.96E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	5.35E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	2.86E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	9.16E-07	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	2.88E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	4.75E-06	mr1520_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	1.41E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	1.91E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	3.43E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	1.35E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	4.38E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	1.53E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	8.12E-06	mr1924_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214569048	NA	2.54E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251