\
| Variant ID: vg1214568067 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14568067 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )
AAGAGAAGTGTAAAGAGCAAAACCAACGTCACAATTTGTTCCAAAGCAAAGTTCTTGTGAAAGGCCATACCGTGAAAATGATTATTGATAGCGAGAGTTG[C/T]
AACAATTTAGCAAGTGAAGAGATGGTCAAGAAGCTTGGCTTGACTACCCATCCACATCCACATCCGTATCATATTCAGTGGTTTAATACATGTGGTAAGA
TCTTACCACATGTATTAAACCACTGAATATGATACGGATGTGGATGTGGATGGGTAGTCAAGCCAAGCTTCTTGACCATCTCTTCACTTGCTAAATTGTT[G/A]
CAACTCTCGCTATCAATAATCATTTTCACGGTATGGCCTTTCACAAGAACTTTGCTTTGGAACAAATTGTGACGTTGGTTTTGCTCTTTACACTTCTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 36.50% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 46.60% | 51.20% | 2.17% | 0.00% | NA |
| All Japonica | 1512 | 81.30% | 18.40% | 0.33% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.30% | 18.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 37.40% | 60.40% | 2.15% | 0.00% | NA |
| Indica III | 913 | 29.00% | 68.10% | 2.85% | 0.00% | NA |
| Indica Intermediate | 786 | 46.30% | 51.00% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 90.60% | 9.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 70.20% | 29.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 24.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214568067 | C -> T | LOC_Os12g25300.1 | synonymous_variant ; p.Cys1232Cys; LOW | synonymous_codon | Average:13.091; most accessible tissue: Callus, score: 33.249 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214568067 | NA | 1.79E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 6.68E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 1.79E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | 1.53E-08 | 6.01E-09 | mr1358_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 7.44E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 7.70E-06 | mr1442_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 5.34E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 1.84E-06 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 8.12E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 2.68E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 1.15E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214568067 | NA | 1.24E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |