RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1214568067:

Variant ID: vg1214568067 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14568067
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAGAAGTGTAAAGAGCAAAACCAACGTCACAATTTGTTCCAAAGCAAAGTTCTTGTGAAAGGCCATACCGTGAAAATGATTATTGATAGCGAGAGTTG[C/T]
AACAATTTAGCAAGTGAAGAGATGGTCAAGAAGCTTGGCTTGACTACCCATCCACATCCACATCCGTATCATATTCAGTGGTTTAATACATGTGGTAAGA

Reverse complement sequence

TCTTACCACATGTATTAAACCACTGAATATGATACGGATGTGGATGTGGATGGGTAGTCAAGCCAAGCTTCTTGACCATCTCTTCACTTGCTAAATTGTT[G/A]
CAACTCTCGCTATCAATAATCATTTTCACGGTATGGCCTTTCACAAGAACTTTGCTTTGGAACAAATTGTGACGTTGGTTTTGCTCTTTACACTTCTCTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	36.50%	1.44%	0.00%	NA
All Indica	2759	46.60%	51.20%	2.17%	0.00%	NA
All Japonica	1512	81.30%	18.40%	0.33%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	81.30%	18.20%	0.50%	0.00%	NA
Indica II	465	37.40%	60.40%	2.15%	0.00%	NA
Indica III	913	29.00%	68.10%	2.85%	0.00%	NA
Indica Intermediate	786	46.30%	51.00%	2.67%	0.00%	NA
Temperate Japonica	767	90.60%	9.30%	0.13%	0.00%	NA
Tropical Japonica	504	70.20%	29.60%	0.20%	0.00%	NA
Japonica Intermediate	241	74.70%	24.10%	1.24%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	73.30%	23.30%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214568067	C -> T	LOC_Os12g25300.1	synonymous_variant ; p.Cys1232Cys; LOW	synonymous_codon	Average:13.091; most accessible tissue: Callus, score: 33.249	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214568067	NA	1.79E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	6.68E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	1.79E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	1.53E-08	6.01E-09	mr1358_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	7.44E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	7.70E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	5.34E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	1.84E-06	mr1578_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	8.12E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214568067	NA	2.68E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 12 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1214568067:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact