\
| Variant ID: vg1214567309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14567309 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )
AGGACTTAGACCTAGAACTTGGGATGATATGAAACGTACAATGAGGTCTAGATTTGTTCCTTCTTACTATGCTTGTGACATGTTAAATAAACTGCAACTT[T/C]
TAAGACAAGGTCCCAATTCTGTAGAAACATACTATCAAGAGATGATGATTGCTTTGTCATGCTGTGATTTGCAAGAAACTGAGGATGCTAGAATTTCTAG
CTAGAAATTCTAGCATCCTCAGTTTCTTGCAAATCACAGCATGACAAAGCAATCATCATCTCTTGATAGTATGTTTCTACAGAATTGGGACCTTGTCTTA[A/G]
AAGTTGCAGTTTATTTAACATGTCACAAGCATAGTAAGAAGGAACAAATCTAGACCTCATTGTACGTTTCATATCATCCCAAGTTCTAGGTCTAAGTCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 85.10% | 14.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.40% | 46.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 87.00% | 12.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214567309 | T -> C | LOC_Os12g25300.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:12.027; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214567309 | NA | 6.82E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 2.80E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 1.96E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 2.55E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 1.06E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 3.73E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 1.86E-06 | mr1227_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 2.49E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 4.83E-07 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | 9.21E-06 | 9.21E-06 | mr1529_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 1.79E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214567309 | NA | 5.92E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |