RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1214552269:

Variant ID: vg1214552269 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14552269
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGACTTATGCTTTTAAATTTTTTTAAAATTTTTCAAATAAGACAGACGATCAAAGTTAGGCACGGAAAATCATGACTGCATTTAAATTGGGACAGAGG[G/A]
AGTATTATATTTAAGTAATATTTATAAGAAATTATTTATAATCTTCTTCATCATTTGAAAAGAATGTATACTTATTTTTTTTAGAAAACATGTCAACGAA

Reverse complement sequence

TTCGTTGACATGTTTTCTAAAAAAAATAAGTATACATTCTTTTCAAATGATGAAGAAGATTATAAATAATTTCTTATAAATATTACTTAAATATAATACT[C/T]
CCTCTGTCCCAATTTAAATGCAGTCATGATTTTCCGTGCCTAACTTTGATCGTCTGTCTTATTTGAAAAATTTTAAAAAAATTTAAAAGCATAAGTCACG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	46.10%	0.38%	0.00%	NA
All Indica	2759	42.70%	56.90%	0.36%	0.00%	NA
All Japonica	1512	80.80%	18.80%	0.40%	0.00%	NA
Aus	269	21.20%	78.40%	0.37%	0.00%	NA
Indica I	595	80.70%	18.30%	1.01%	0.00%	NA
Indica II	465	35.50%	63.90%	0.65%	0.00%	NA
Indica III	913	23.10%	76.90%	0.00%	0.00%	NA
Indica Intermediate	786	41.10%	58.80%	0.13%	0.00%	NA
Temperate Japonica	767	89.80%	9.80%	0.39%	0.00%	NA
Tropical Japonica	504	70.00%	29.40%	0.60%	0.00%	NA
Japonica Intermediate	241	74.30%	25.70%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214552269	G -> A	LOC_Os12g25290.1	upstream_gene_variant ; 3377.0bp to feature; MODIFIER	silent_mutation	Average:21.095; most accessible tissue: Callus, score: 40.124	N	N	N	N
vg1214552269	G -> A	LOC_Os12g25280-LOC_Os12g25290	intergenic_region ; MODIFIER	silent_mutation	Average:21.095; most accessible tissue: Callus, score: 40.124	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214552269	NA	2.34E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	1.65E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	2.88E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	7.58E-06	7.58E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	9.52E-07	9.52E-07	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	1.06E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	2.22E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	2.03E-09	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	4.57E-06	1.54E-06	mr1030_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214552269	NA	5.67E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 36 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1214552269:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact