\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214417086:

Variant ID: vg1214417086 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14417086
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.15, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATCTTCAAGTTCAGAAAATTATACATTTGCAAAGACTTGCGAATAATCTGCCAGATGCATTTACCAATTATAAAGGTGTGACTAAATCTTTAATTCC[T/C]
GCTCAGAATGCGCCAGAAAGAGTGGAGGTACCAAATAAAACCACTCAACTTCCACTCACTAAAAAAAGAGGAAGAAGTATGGCCACTCAGCGAGAAACAA

Reverse complement sequence

TTGTTTCTCGCTGAGTGGCCATACTTCTTCCTCTTTTTTTAGTGAGTGGAAGTTGAGTGGTTTTATTTGGTACCTCCACTCTTTCTGGCGCATTCTGAGC[A/G]
GGAATTAAAGATTTAGTCACACCTTTATAATTGGTAAATGCATCTGGCAGATTATTCGCAAGTCTTTGCAAATGTATAATTTTCTGAACTTGAAGATCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 0.50% 34.60% 17.41% NA
All Indica  2759 40.80% 0.60% 33.02% 25.63% NA
All Japonica  1512 57.40% 0.30% 35.45% 6.81% NA
Aus  269 57.60% 0.00% 40.89% 1.49% NA
Indica I  595 25.40% 0.70% 23.53% 50.42% NA
Indica II  465 41.90% 0.60% 36.56% 20.86% NA
Indica III  913 49.30% 0.30% 38.44% 11.94% NA
Indica Intermediate  786 41.90% 0.80% 31.81% 25.57% NA
Temperate Japonica  767 85.50% 0.70% 8.60% 5.22% NA
Tropical Japonica  504 20.20% 0.00% 70.04% 9.72% NA
Japonica Intermediate  241 45.60% 0.00% 48.55% 5.81% NA
VI/Aromatic  96 50.00% 2.10% 46.88% 1.04% NA
Intermediate  90 54.40% 0.00% 36.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214417086 T -> C LOC_Os12g25100.1 synonymous_variant ; p.Pro451Pro; LOW synonymous_codon Average:12.39; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg1214417086 T -> DEL LOC_Os12g25100.1 N frameshift_variant Average:12.39; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214417086 NA 1.31E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.12E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.16E-17 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.46E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 5.34E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 3.60E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 4.94E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 3.65E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 6.22E-17 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.08E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 3.82E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 1.86E-07 NA mr1023_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 4.60E-06 1.42E-21 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 2.90E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.32E-17 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.83E-19 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.42E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.41E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 1.01E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 7.39E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 2.21E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 9.12E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214417086 NA 2.76E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251