\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214390025:

Variant ID: vg1214390025 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14390025
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.29, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGATGAAAAAGACAGTATAGATCACACATATCACAAGTAAGTGAGGTATAGGATATGTCTTTATTAATTTACTAGCAAAATGCCCGTGCGTTGCAC[T/C]
GGGTAATGTCGTGTTCGATAAATGTTGATTGAATGATTTTTTTAATCACAAAGGTTTTAAACAATTATTCCACGTGTACGTGTATGATATGAACTATGTT

Reverse complement sequence

AACATAGTTCATATCATACACGTACACGTGGAATAATTGTTTAAAACCTTTGTGATTAAAAAAATCATTCAATCAACATTTATCGAACACGACATTACCC[A/G]
GTGCAACGCACGGGCATTTTGCTAGTAAATTAATAAAGACATATCCTATACCTCACTTACTTGTGATATGTGTGATCTATACTGTCTTTTTCATCAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 24.50% 0.28% 40.35% NA
All Indica  2759 29.70% 12.50% 0.36% 57.45% NA
All Japonica  1512 52.00% 46.80% 0.07% 1.12% NA
Aus  269 2.60% 20.80% 0.37% 76.21% NA
Indica I  595 23.00% 8.60% 0.67% 67.73% NA
Indica II  465 46.00% 14.60% 0.43% 38.92% NA
Indica III  913 26.40% 12.60% 0.33% 60.68% NA
Indica Intermediate  786 29.00% 14.00% 0.13% 56.87% NA
Temperate Japonica  767 83.70% 15.60% 0.00% 0.65% NA
Tropical Japonica  504 12.10% 86.90% 0.00% 0.99% NA
Japonica Intermediate  241 34.40% 62.20% 0.41% 2.90% NA
VI/Aromatic  96 4.20% 15.60% 0.00% 80.21% NA
Intermediate  90 33.30% 40.00% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214390025 T -> C LOC_Os12g25050-LOC_Os12g25070 intergenic_region ; MODIFIER silent_mutation Average:40.26; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N
vg1214390025 T -> DEL N N silent_mutation Average:40.26; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214390025 NA 2.33E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 2.31E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.73E-17 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 7.04E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.08E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.05E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.21E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.07E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.06E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.00E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 6.62E-17 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.34E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 6.07E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.07E-16 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 4.62E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 5.81E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.44E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 1.76E-06 1.09E-21 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.32E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 1.32E-06 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.11E-07 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.27E-17 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 9.79E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 2.14E-19 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 7.44E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.63E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.01E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.07E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.73E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 5.91E-17 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 5.38E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 1.13E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 3.02E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 4.86E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214390025 NA 2.13E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251