\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214375050:

Variant ID: vg1214375050 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14375050
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GATCCGCTCTACGTGGAGGTTGAAGCCGACATTTGGGAAAGCGAGCAAGGCAAGTCACATCATCCTTGAACATATTGAATCCCAGTTTATAAAATTATTT[T/C]
GATTTAAGTTAATGCATTATCGCTTTATTTAAATTCCCGCGTTATCACTGTTTTATTTAGCCATGCCTATTTACCTTTGTTATGACCTTATTATTATTGT

Reverse complement sequence

ACAATAATAATAAGGTCATAACAAAGGTAAATAGGCATGGCTAAATAAAACAGTGATAACGCGGGAATTTAAATAAAGCGATAATGCATTAACTTAAATC[A/G]
AAATAATTTTATAAACTGGGATTCAATATGTTCAAGGATGATGTGACTTGCCTTGCTCGCTTTCCCAAATGTCGGCTTCAACCTCCACGTAGAGCGGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 12.70% 6.83% 51.78% NA
All Indica  2759 19.90% 6.40% 5.91% 67.78% NA
All Japonica  1512 50.30% 25.00% 8.80% 15.94% NA
Aus  269 3.30% 8.20% 4.46% 84.01% NA
Indica I  595 27.20% 2.00% 4.87% 65.88% NA
Indica II  465 23.00% 8.00% 3.66% 65.38% NA
Indica III  913 14.30% 8.40% 7.23% 69.99% NA
Indica Intermediate  786 19.10% 6.40% 6.49% 68.07% NA
Temperate Japonica  767 80.10% 5.00% 2.87% 12.13% NA
Tropical Japonica  504 12.50% 52.20% 13.69% 21.63% NA
Japonica Intermediate  241 34.40% 32.00% 17.43% 16.18% NA
VI/Aromatic  96 5.20% 8.30% 5.21% 81.25% NA
Intermediate  90 37.80% 15.60% 11.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214375050 T -> C LOC_Os12g25040.1 upstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:14.622; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N
vg1214375050 T -> C LOC_Os12g25050.1 downstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:14.622; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N
vg1214375050 T -> C LOC_Os12g25040-LOC_Os12g25050 intergenic_region ; MODIFIER silent_mutation Average:14.622; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N
vg1214375050 T -> DEL N N silent_mutation Average:14.622; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214375050 NA 9.45E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 5.31E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 5.31E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.80E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.72E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 6.39E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.63E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 2.21E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 5.00E-08 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 5.78E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 8.80E-09 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 1.80E-07 1.79E-07 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 5.01E-14 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.79E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.24E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 4.04E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.12E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 9.81E-07 1.73E-11 mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 1.01E-13 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 8.95E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 2.02E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 6.24E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 7.30E-10 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 6.81E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 6.93E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 9.00E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 4.70E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 4.56E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 2.13E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 3.03E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 1.01E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 1.36E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214375050 NA 1.51E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251