\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214365446:

Variant ID: vg1214365446 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14365446
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTATTAGCTAGTATATAGGTTAGCTAGAATGTATGTATACTATGTATATTAGAAGTATAGGAATAGATTATCTTTCTCTTTTCTTTCCACTTAGCTTA[G/A]
ATAATATATTATGAGAATGAGTAACTACTGCTTGTGTGTCACTCTACCCTTGGATTATTTTAACCCCTGCTTAGAATATGATTATTACAAGTAATATATA

Reverse complement sequence

TATATATTACTTGTAATAATCATATTCTAAGCAGGGGTTAAAATAATCCAAGGGTAGAGTGACACACAAGCAGTAGTTACTCATTCTCATAATATATTAT[C/T]
TAAGCTAAGTGGAAAGAAAAGAGAAAGATAATCTATTCCTATACTTCTAATATACATAGTATACATACATTCTAGCTAACCTATATACTAGCTAATACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 24.00% 10.47% 4.87% NA
All Indica  2759 68.90% 11.60% 14.57% 4.93% NA
All Japonica  1512 52.50% 46.80% 0.53% 0.13% NA
Aus  269 39.80% 20.10% 18.96% 21.19% NA
Indica I  595 67.90% 7.20% 20.67% 4.20% NA
Indica II  465 68.20% 14.60% 13.98% 3.23% NA
Indica III  913 69.70% 12.30% 12.05% 6.02% NA
Indica Intermediate  786 69.20% 12.30% 13.23% 5.22% NA
Temperate Japonica  767 84.00% 15.60% 0.39% 0.00% NA
Tropical Japonica  504 12.90% 86.70% 0.20% 0.20% NA
Japonica Intermediate  241 35.30% 62.70% 1.66% 0.41% NA
VI/Aromatic  96 20.80% 15.60% 29.17% 34.38% NA
Intermediate  90 51.10% 40.00% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214365446 G -> DEL N N silent_mutation Average:44.16; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N
vg1214365446 G -> A LOC_Os12g25030.1 downstream_gene_variant ; 3155.0bp to feature; MODIFIER silent_mutation Average:44.16; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N
vg1214365446 G -> A LOC_Os12g25040.1 downstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:44.16; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N
vg1214365446 G -> A LOC_Os12g25030-LOC_Os12g25040 intergenic_region ; MODIFIER silent_mutation Average:44.16; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214365446 NA 3.86E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 5.91E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 6.88E-07 NA mr1428 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 3.49E-08 3.49E-08 mr1428 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 2.57E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 6.36E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 8.62E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 3.88E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 1.60E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 8.57E-06 8.54E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 3.48E-17 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 6.31E-06 2.05E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 1.28E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 8.55E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 2.15E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 8.08E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 3.69E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 4.18E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 1.94E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365446 NA 6.18E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251