\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214365378:

Variant ID: vg1214365378 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14365378
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGGCTGTCGTAAGGAACTCGGCTGTTAGGGGTGGCTTCTCGGAGTACCAGGAGGGCATCGAATAGAGGGTATTAGCTAGTATATAGGTTAGCTAGAAT[G/A]
TATGTATACTATGTATATTAGAAGTATAGGAATAGATTATCTTTCTCTTTTCTTTCCACTTAGCTTAGATAATATATTATGAGAATGAGTAACTACTGCT

Reverse complement sequence

AGCAGTAGTTACTCATTCTCATAATATATTATCTAAGCTAAGTGGAAAGAAAAGAGAAAGATAATCTATTCCTATACTTCTAATATACATAGTATACATA[C/T]
ATTCTAGCTAACCTATATACTAGCTAATACCCTCTATTCGATGCCCTCCTGGTACTCCGAGAAGCCACCCCTAACAGCCGAGTTCCTTACGACAGCCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 23.80% 12.82% 2.77% NA
All Indica  2759 67.60% 11.50% 18.99% 1.92% NA
All Japonica  1512 52.60% 46.60% 0.53% 0.20% NA
Aus  269 48.30% 20.40% 10.41% 20.82% NA
Indica I  595 69.60% 7.20% 21.18% 2.02% NA
Indica II  465 69.90% 14.00% 14.84% 1.29% NA
Indica III  913 65.90% 12.20% 20.48% 1.42% NA
Indica Intermediate  786 66.50% 12.60% 18.07% 2.80% NA
Temperate Japonica  767 84.00% 15.60% 0.39% 0.00% NA
Tropical Japonica  504 12.50% 86.90% 0.40% 0.20% NA
Japonica Intermediate  241 36.90% 61.00% 1.24% 0.83% NA
VI/Aromatic  96 30.20% 15.60% 35.42% 18.75% NA
Intermediate  90 47.80% 37.80% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214365378 G -> DEL N N silent_mutation Average:45.354; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1214365378 G -> A LOC_Os12g25020.1 downstream_gene_variant ; 4992.0bp to feature; MODIFIER silent_mutation Average:45.354; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1214365378 G -> A LOC_Os12g25030.1 downstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:45.354; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1214365378 G -> A LOC_Os12g25040.1 downstream_gene_variant ; 792.0bp to feature; MODIFIER silent_mutation Average:45.354; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1214365378 G -> A LOC_Os12g25030-LOC_Os12g25040 intergenic_region ; MODIFIER silent_mutation Average:45.354; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214365378 NA 4.89E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.66E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 3.39E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 8.62E-06 NA mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 2.45E-07 2.45E-07 mr1428 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 4.26E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 8.66E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 2.04E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 6.30E-06 1.98E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 2.38E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 6.50E-06 6.47E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.02E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.87E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 3.88E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 5.44E-07 1.02E-11 mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.32E-07 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 9.39E-09 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 6.05E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 8.10E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.86E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 2.08E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 1.08E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 9.76E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365378 NA 5.70E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251