\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214365279:

Variant ID: vg1214365279 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14365279
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGCTCAGTACGGGTATTCCTCCGCGCGTGTATATAATCCTAAGTTAATTTCCTGGGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGTATGGTCATGG[T/C]
GGGCTGTCGTAAGGAACTCGGCTGTTAGGGGTGGCTTCTCGGAGTACCAGGAGGGCATCGAATAGAGGGTATTAGCTAGTATATAGGTTAGCTAGAATGT

Reverse complement sequence

ACATTCTAGCTAACCTATATACTAGCTAATACCCTCTATTCGATGCCCTCCTGGTACTCCGAGAAGCCACCCCTAACAGCCGAGTTCCTTACGACAGCCC[A/G]
CCATGACCATACAACCGGGGCTAAATACGGAGGAATACCCTCCCCAGGAAATTAACTTAGGATTATATACACGCGCGGAGGAATACCCGTACTGAGCTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 36.60% 9.23% 2.96% NA
All Indica  2759 57.10% 31.60% 9.82% 1.49% NA
All Japonica  1512 49.90% 49.40% 0.60% 0.13% NA
Aus  269 15.20% 20.40% 36.43% 27.88% NA
Indica I  595 78.00% 9.40% 12.44% 0.17% NA
Indica II  465 41.50% 48.20% 9.68% 0.65% NA
Indica III  913 54.00% 36.00% 8.21% 1.75% NA
Indica Intermediate  786 54.20% 33.30% 9.80% 2.67% NA
Temperate Japonica  767 79.30% 20.50% 0.26% 0.00% NA
Tropical Japonica  504 12.70% 86.70% 0.60% 0.00% NA
Japonica Intermediate  241 34.00% 63.50% 1.66% 0.83% NA
VI/Aromatic  96 10.40% 17.70% 52.08% 19.79% NA
Intermediate  90 45.60% 42.20% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214365279 T -> C LOC_Os12g25020.1 downstream_gene_variant ; 4893.0bp to feature; MODIFIER silent_mutation Average:43.838; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1214365279 T -> C LOC_Os12g25030.1 downstream_gene_variant ; 2988.0bp to feature; MODIFIER silent_mutation Average:43.838; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1214365279 T -> C LOC_Os12g25040.1 downstream_gene_variant ; 891.0bp to feature; MODIFIER silent_mutation Average:43.838; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1214365279 T -> C LOC_Os12g25030-LOC_Os12g25040 intergenic_region ; MODIFIER silent_mutation Average:43.838; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1214365279 T -> DEL N N silent_mutation Average:43.838; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214365279 NA 1.55E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.86E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.37E-17 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 1.51E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.22E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.77E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 5.57E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 7.82E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.36E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.44E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 1.03E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 7.50E-22 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.77E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 6.34E-18 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 5.55E-08 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 8.82E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.18E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.87E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.06E-07 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.50E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 1.81E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 3.31E-07 3.42E-09 mr1407_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 7.77E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 4.20E-19 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 1.09E-07 NA mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.46E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.23E-10 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 1.97E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.81E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 5.38E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 1.34E-13 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 6.37E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 9.53E-07 1.49E-09 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 3.30E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.40E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.45E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.32E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 2.03E-06 NA mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214365279 NA 2.61E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251