\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214354909:

Variant ID: vg1214354909 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14354909
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGGTAAAACAGGATGTGTGATCTACTTGAATGGAACATACTATAGGTATCTCCTGGGTTCCAACAAGCTTGTGTACATGCGGCACCGACGGTTCCTA[T/C]
GCACAAATCACAAGTACTGCAAGATGAAGGCGGAGTTCGATGGCACTGAAGAGACTGATCCTGCACCAAAACCTACATCGGGGGAAAATGTGTGTCCAAT

Reverse complement sequence

ATTGGACACACATTTTCCCCCGATGTAGGTTTTGGTGCAGGATCAGTCTCTTCAGTGCCATCGAACTCCGCCTTCATCTTGCAGTACTTGTGATTTGTGC[A/G]
TAGGAACCGTCGGTGCCGCATGTACACAAGCTTGTTGGAACCCAGGAGATACCTATAGTATGTTCCATTCAAGTAGATCACACATCCTGTTTTACCTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 24.10% 1.80% 49.70% NA
All Indica  2759 12.60% 11.90% 2.97% 72.53% NA
All Japonica  1512 49.90% 46.70% 0.00% 3.44% NA
Aus  269 6.70% 20.40% 0.37% 72.49% NA
Indica I  595 27.40% 7.10% 0.34% 65.21% NA
Indica II  465 13.10% 14.80% 3.66% 68.39% NA
Indica III  913 3.60% 12.60% 4.05% 79.74% NA
Indica Intermediate  786 11.60% 13.00% 3.31% 72.14% NA
Temperate Japonica  767 79.10% 15.60% 0.00% 5.22% NA
Tropical Japonica  504 12.50% 86.70% 0.00% 0.79% NA
Japonica Intermediate  241 34.90% 61.80% 0.00% 3.32% NA
VI/Aromatic  96 4.20% 15.60% 1.04% 79.17% NA
Intermediate  90 31.10% 40.00% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214354909 T -> C LOC_Os12g25000.1 missense_variant ; p.Cys311Arg; MODERATE nonsynonymous_codon ; C311R Average:13.551; most accessible tissue: Minghui63 flower, score: 26.22 unknown unknown TOLERATED 1.00
vg1214354909 T -> DEL LOC_Os12g25000.1 N frameshift_variant Average:13.551; most accessible tissue: Minghui63 flower, score: 26.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214354909 NA 3.44E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 7.53E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 5.02E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 6.48E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 2.62E-18 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.02E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.03E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.26E-16 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 5.84E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 2.72E-18 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.88E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 4.09E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 2.66E-18 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.58E-17 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 1.49E-07 NA mr1601 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.46E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.50E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.09E-08 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 7.42E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.02E-16 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 4.57E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.21E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.74E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 1.99E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 2.89E-06 3.58E-22 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.68E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 2.90E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 4.28E-18 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.10E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 8.54E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 1.09E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 8.30E-20 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.74E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.22E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.26E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 5.76E-17 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 2.84E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 1.53E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214354909 NA 3.36E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251