Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214347472:

Variant ID: vg1214347472 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14347472
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.09, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCTGTCCAGGAAATTATTCTGCCCAGTGTGTTATTGATCTGACGATCTGGGAGAAAAGTTATGCCTTTATGAGCACTCGAACCTCTCCTTATATATGG[G/C]
GAAGAGCCGAAATTATAATGTATAGCTCATATGTCTTACGGACTAAGCTAACAGATATATTACAACTGTAATTGATTAGGACTATAGAATATTTCCTTGA

Reverse complement sequence

TCAAGGAAATATTCTATAGTCCTAATCAATTACAGTTGTAATATATCTGTTAGCTTAGTCCGTAAGACATATGAGCTATACATTATAATTTCGGCTCTTC[C/G]
CCATATATAAGGAGAGGTTCGAGTGCTCATAAAGGCATAACTTTTCTCCCAGATCGTCAGATCAATAACACACTGGGCAGAATAATTTCCTGGACAGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.20%	23.80%	0.63%	51.27%	NA
All Indica	2759	12.00%	12.10%	1.01%	74.85%	NA
All Japonica	1512	46.80%	49.70%	0.07%	3.37%	NA
Aus	269	20.40%	4.50%	0.37%	74.72%	NA
Indica I	595	7.20%	27.60%	1.01%	64.20%	NA
Indica II	465	14.80%	12.50%	0.43%	72.26%	NA
Indica III	913	12.80%	3.40%	0.55%	83.24%	NA
Indica Intermediate	786	13.00%	10.40%	1.91%	74.68%	NA
Temperate Japonica	767	15.60%	79.30%	0.00%	5.08%	NA
Tropical Japonica	504	86.90%	12.10%	0.20%	0.79%	NA
Japonica Intermediate	241	62.20%	34.40%	0.00%	3.32%	NA
VI/Aromatic	96	15.60%	4.20%	0.00%	80.21%	NA
Intermediate	90	41.10%	26.70%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214347472	G -> C	LOC_Os12g24990.1	upstream_gene_variant ; 267.0bp to feature; MODIFIER	silent_mutation	Average:37.25; most accessible tissue: Callus, score: 77.355	N	N	N	N
vg1214347472	G -> C	LOC_Os12g24990-LOC_Os12g25000	intergenic_region ; MODIFIER	silent_mutation	Average:37.25; most accessible tissue: Callus, score: 77.355	N	N	N	N
vg1214347472	G -> DEL	N	N	silent_mutation	Average:37.25; most accessible tissue: Callus, score: 77.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214347472	NA	2.39E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.49E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	7.55E-17	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	6.69E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.42E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.69E-15	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.01E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	3.88E-17	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.77E-17	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	1.91E-16	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	8.13E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	7.93E-16	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	4.78E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	1.23E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	9.06E-10	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	6.75E-21	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	7.48E-09	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	1.51E-16	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	4.14E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	4.38E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	6.13E-07	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	1.33E-18	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	4.25E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	5.47E-08	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	2.57E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	3.00E-16	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	5.05E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472	NA	4.14E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251