\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214347472:

Variant ID: vg1214347472 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14347472
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.09, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTGTCCAGGAAATTATTCTGCCCAGTGTGTTATTGATCTGACGATCTGGGAGAAAAGTTATGCCTTTATGAGCACTCGAACCTCTCCTTATATATGG[G/C]
GAAGAGCCGAAATTATAATGTATAGCTCATATGTCTTACGGACTAAGCTAACAGATATATTACAACTGTAATTGATTAGGACTATAGAATATTTCCTTGA

Reverse complement sequence

TCAAGGAAATATTCTATAGTCCTAATCAATTACAGTTGTAATATATCTGTTAGCTTAGTCCGTAAGACATATGAGCTATACATTATAATTTCGGCTCTTC[C/G]
CCATATATAAGGAGAGGTTCGAGTGCTCATAAAGGCATAACTTTTCTCCCAGATCGTCAGATCAATAACACACTGGGCAGAATAATTTCCTGGACAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 23.80% 0.63% 51.27% NA
All Indica  2759 12.00% 12.10% 1.01% 74.85% NA
All Japonica  1512 46.80% 49.70% 0.07% 3.37% NA
Aus  269 20.40% 4.50% 0.37% 74.72% NA
Indica I  595 7.20% 27.60% 1.01% 64.20% NA
Indica II  465 14.80% 12.50% 0.43% 72.26% NA
Indica III  913 12.80% 3.40% 0.55% 83.24% NA
Indica Intermediate  786 13.00% 10.40% 1.91% 74.68% NA
Temperate Japonica  767 15.60% 79.30% 0.00% 5.08% NA
Tropical Japonica  504 86.90% 12.10% 0.20% 0.79% NA
Japonica Intermediate  241 62.20% 34.40% 0.00% 3.32% NA
VI/Aromatic  96 15.60% 4.20% 0.00% 80.21% NA
Intermediate  90 41.10% 26.70% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214347472 G -> C LOC_Os12g24990.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:37.25; most accessible tissue: Callus, score: 77.355 N N N N
vg1214347472 G -> C LOC_Os12g24990-LOC_Os12g25000 intergenic_region ; MODIFIER silent_mutation Average:37.25; most accessible tissue: Callus, score: 77.355 N N N N
vg1214347472 G -> DEL N N silent_mutation Average:37.25; most accessible tissue: Callus, score: 77.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214347472 NA 2.39E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.49E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 7.55E-17 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 6.69E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.42E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.69E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.01E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 3.88E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.77E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 1.91E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 8.13E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 7.93E-16 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 4.78E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 1.23E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 9.06E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 6.75E-21 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 7.48E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 1.51E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 4.14E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 4.38E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 6.13E-07 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 1.33E-18 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 4.25E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 5.47E-08 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 2.57E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 3.00E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 5.05E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214347472 NA 4.14E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251