\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214346774:

Variant ID: vg1214346774 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14346774
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAGTCATATTCATCATCGAAGTCACCATAATCGATAATCACAGTCGGGGAGCGGGAAACAACGCTTGGAGTGCTGAGGTATTCTTCGATCTCTTTTGT[G/T]
GAACACGATCCGAGTTGTTGGAGAATTACGCCGACTTCCCTGGAGCTGGATCTAGTTATGGTCGAAATCGAGCCAGATCTAGACCTACGGGGAGAAGGTG

Reverse complement sequence

CACCTTCTCCCCGTAGGTCTAGATCTGGCTCGATTTCGACCATAACTAGATCCAGCTCCAGGGAAGTCGGCGTAATTCTCCAACAACTCGGATCGTGTTC[C/A]
ACAAAAGAGATCGAAGAATACCTCAGCACTCCAAGCGTTGTTTCCCGCTCCCCGACTGTGATTATCGATTATGGTGACTTCGATGATGAATATGACTTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.80% 23.80% 0.40% 51.02% NA
All Indica  2759 12.80% 12.10% 0.54% 74.56% NA
All Japonica  1512 46.80% 49.70% 0.13% 3.31% NA
Aus  269 20.80% 4.80% 0.74% 73.61% NA
Indica I  595 7.90% 28.20% 0.67% 63.19% NA
Indica II  465 15.10% 12.70% 0.43% 71.83% NA
Indica III  913 13.30% 2.50% 0.44% 83.79% NA
Indica Intermediate  786 14.80% 10.60% 0.64% 74.05% NA
Temperate Japonica  767 15.60% 79.30% 0.13% 4.95% NA
Tropical Japonica  504 86.90% 12.30% 0.00% 0.79% NA
Japonica Intermediate  241 62.20% 34.00% 0.41% 3.32% NA
VI/Aromatic  96 15.60% 3.10% 0.00% 81.25% NA
Intermediate  90 41.10% 27.80% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214346774 G -> DEL LOC_Os12g24990.1 N frameshift_variant Average:29.49; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1214346774 G -> T LOC_Os12g24990.1 synonymous_variant ; p.Ser144Ser; LOW synonymous_codon Average:29.49; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214346774 NA 3.11E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 3.93E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 6.34E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 5.01E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.49E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.17E-14 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 2.35E-16 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.50E-16 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.23E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 7.14E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 3.39E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 7.07E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 8.40E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.98E-20 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 5.13E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 4.15E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 4.01E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 3.74E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 5.21E-18 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 9.06E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 8.67E-06 3.49E-09 mr1554_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.16E-15 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 5.01E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214346774 NA 1.89E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251