\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214331148:

Variant ID: vg1214331148 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14331148
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTCGTCGTCTTCGTCCTCGGCTCCGCGTCGTCAAGCCTCGTGCCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTT[C/T]
GCCTCCGTCTTCCCCGAGCCGTGTCCGCCGTGCCTGTTCGTCATCATCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCCTCTCCCTCGCTGCCCCG

Reverse complement sequence

CGGGGCAGCGAGGGAGAGGGATCCTTACCACCACGCGACGAGGCGTGGGAACGATGATGACGAACAGGCACGGCGGACACGGCTCGGGGAAGACGGAGGC[G/A]
AACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGGCACGAGGCTTGACGACGCGGAGCCGAGGACGAAGACGACGACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 23.20% 0.30% 1.25% NA
All Indica  2759 88.10% 10.60% 0.40% 0.91% NA
All Japonica  1512 51.10% 46.60% 0.20% 2.05% NA
Aus  269 79.60% 20.10% 0.00% 0.37% NA
Indica I  595 92.80% 6.40% 0.50% 0.34% NA
Indica II  465 84.10% 14.40% 0.22% 1.29% NA
Indica III  913 88.00% 11.20% 0.11% 0.77% NA
Indica Intermediate  786 87.20% 10.80% 0.76% 1.27% NA
Temperate Japonica  767 80.20% 15.60% 0.39% 3.78% NA
Tropical Japonica  504 13.70% 86.10% 0.00% 0.20% NA
Japonica Intermediate  241 36.90% 62.70% 0.00% 0.41% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214331148 C -> DEL N N silent_mutation Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1214331148 C -> T LOC_Os12g24960.1 upstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1214331148 C -> T LOC_Os12g24950.1 downstream_gene_variant ; 3537.0bp to feature; MODIFIER silent_mutation Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1214331148 C -> T LOC_Os12g24970.1 downstream_gene_variant ; 2653.0bp to feature; MODIFIER silent_mutation Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1214331148 C -> T LOC_Os12g24960-LOC_Os12g24970 intergenic_region ; MODIFIER silent_mutation Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214331148 4.84E-06 1.54E-06 mr1339 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148 NA 8.55E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148 NA 1.12E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148 8.18E-06 8.18E-06 mr1499 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148 NA 2.83E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148 2.62E-06 2.62E-06 mr1881 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251