\
| Variant ID: vg1214331148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14331148 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )
CCGTCGTCGTCTTCGTCCTCGGCTCCGCGTCGTCAAGCCTCGTGCCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTT[C/T]
GCCTCCGTCTTCCCCGAGCCGTGTCCGCCGTGCCTGTTCGTCATCATCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCCTCTCCCTCGCTGCCCCG
CGGGGCAGCGAGGGAGAGGGATCCTTACCACCACGCGACGAGGCGTGGGAACGATGATGACGAACAGGCACGGCGGACACGGCTCGGGGAAGACGGAGGC[G/A]
AACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGGCACGAGGCTTGACGACGCGGAGCCGAGGACGAAGACGACGACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 23.20% | 0.30% | 1.25% | NA |
| All Indica | 2759 | 88.10% | 10.60% | 0.40% | 0.91% | NA |
| All Japonica | 1512 | 51.10% | 46.60% | 0.20% | 2.05% | NA |
| Aus | 269 | 79.60% | 20.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 92.80% | 6.40% | 0.50% | 0.34% | NA |
| Indica II | 465 | 84.10% | 14.40% | 0.22% | 1.29% | NA |
| Indica III | 913 | 88.00% | 11.20% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 87.20% | 10.80% | 0.76% | 1.27% | NA |
| Temperate Japonica | 767 | 80.20% | 15.60% | 0.39% | 3.78% | NA |
| Tropical Japonica | 504 | 13.70% | 86.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 36.90% | 62.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214331148 | C -> DEL | N | N | silent_mutation | Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1214331148 | C -> T | LOC_Os12g24960.1 | upstream_gene_variant ; 289.0bp to feature; MODIFIER | silent_mutation | Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1214331148 | C -> T | LOC_Os12g24950.1 | downstream_gene_variant ; 3537.0bp to feature; MODIFIER | silent_mutation | Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1214331148 | C -> T | LOC_Os12g24970.1 | downstream_gene_variant ; 2653.0bp to feature; MODIFIER | silent_mutation | Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1214331148 | C -> T | LOC_Os12g24960-LOC_Os12g24970 | intergenic_region ; MODIFIER | silent_mutation | Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214331148 | 4.84E-06 | 1.54E-06 | mr1339 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214331148 | NA | 8.55E-09 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214331148 | NA | 1.12E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214331148 | 8.18E-06 | 8.18E-06 | mr1499 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214331148 | NA | 2.83E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214331148 | 2.62E-06 | 2.62E-06 | mr1881 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |