\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214314544:

Variant ID: vg1214314544 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14314544
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGTGGAGCAATGACTCGCGGCCTGACGCTCCGGAAGAAAGCTTCTGGATTTTCATTAAAGTTTTTCGGCAAGTTGAAACCAGTCATGCACTACCCT[A/G]
TTTTCACAACAAAAGTGAAAACAACCAAGGTTAGCCTACAAAGGGCAGTGGTTATACAGAGGTAAATATAAAGTATTAGTTCAGGTATTCTCTATTATGA

Reverse complement sequence

TCATAATAGAGAATACCTGAACTAATACTTTATATTTACCTCTGTATAACCACTGCCCTTTGTAGGCTAACCTTGGTTGTTTTCACTTTTGTTGTGAAAA[T/C]
AGGGTAGTGCATGACTGGTTTCAACTTGCCGAAAAACTTTAATGAAAATCCAGAAGCTTTCTTCCGGAGCGTCAGGCCGCGAGTCATTGCTCCACAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.60% 20.50% 0.49% 54.44% NA
All Indica  2759 12.50% 7.00% 0.69% 79.85% NA
All Japonica  1512 47.00% 49.70% 0.26% 3.04% NA
Aus  269 20.40% 0.70% 0.00% 78.81% NA
Indica I  595 7.60% 6.60% 0.84% 85.04% NA
Indica II  465 15.30% 13.10% 0.22% 71.40% NA
Indica III  913 12.80% 3.10% 0.22% 83.90% NA
Indica Intermediate  786 14.10% 8.30% 1.40% 76.21% NA
Temperate Japonica  767 15.60% 79.50% 0.39% 4.43% NA
Tropical Japonica  504 87.30% 11.70% 0.20% 0.79% NA
Japonica Intermediate  241 62.70% 34.00% 0.00% 3.32% NA
VI/Aromatic  96 14.60% 2.10% 0.00% 83.33% NA
Intermediate  90 42.20% 22.20% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214314544 A -> DEL N N silent_mutation Average:30.379; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1214314544 A -> G LOC_Os12g24920.1 upstream_gene_variant ; 11.0bp to feature; MODIFIER silent_mutation Average:30.379; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1214314544 A -> G LOC_Os12g24930.1 upstream_gene_variant ; 4414.0bp to feature; MODIFIER silent_mutation Average:30.379; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1214314544 A -> G LOC_Os12g24920-LOC_Os12g24930 intergenic_region ; MODIFIER silent_mutation Average:30.379; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214314544 NA 4.76E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 2.99E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 1.07E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 3.91E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 3.21E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 6.04E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 6.74E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 2.29E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 3.06E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 5.80E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 2.30E-06 2.00E-21 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 5.00E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 9.84E-17 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 3.27E-06 NA mr1274_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 7.53E-19 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 1.24E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 3.50E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 4.23E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 5.22E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 4.23E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214314544 NA 7.08E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251