\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214284699:

Variant ID: vg1214284699 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14284699
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTCTCACGTGACGGATTGAAAGCGTTTAAAGTTTAGTGAACTTTTAGTATACATAGTAGATAGATAGATAGATTCCTTCATTCTTTTGTGTTCAGTT[G/A]
GGCTACATAACTATGACCATGATGCTCTATAGTATATTTCAGTTCTTCCATTGTTTGTTTTTTTTGCAAAAGTGATGGGGAACGAAAATAAAGAATAGAT

Reverse complement sequence

ATCTATTCTTTATTTTCGTTCCCCATCACTTTTGCAAAAAAAACAAACAATGGAAGAACTGAAATATACTATAGAGCATCATGGTCATAGTTATGTAGCC[C/T]
AACTGAACACAAAAGAATGAAGGAATCTATCTATCTATCTACTATGTATACTAAAAGTTCACTAAACTTTAAACGCTTTCAATCCGTCACGTGAGACTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 8.80% 0.55% 9.80% NA
All Indica  2759 68.60% 14.80% 0.87% 15.77% NA
All Japonica  1512 97.60% 0.50% 0.07% 1.85% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 56.60% 42.40% 0.50% 0.50% NA
Indica II  465 66.20% 4.50% 2.15% 27.10% NA
Indica III  913 74.60% 3.60% 0.44% 21.36% NA
Indica Intermediate  786 72.10% 12.80% 0.89% 14.12% NA
Temperate Japonica  767 96.10% 0.30% 0.13% 3.52% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214284699 G -> DEL N N silent_mutation Average:47.066; most accessible tissue: Callus, score: 81.633 N N N N
vg1214284699 G -> A LOC_Os12g24890.1 upstream_gene_variant ; 4022.0bp to feature; MODIFIER silent_mutation Average:47.066; most accessible tissue: Callus, score: 81.633 N N N N
vg1214284699 G -> A LOC_Os12g24900.1 downstream_gene_variant ; 2135.0bp to feature; MODIFIER silent_mutation Average:47.066; most accessible tissue: Callus, score: 81.633 N N N N
vg1214284699 G -> A LOC_Os12g24900-LOC_Os12g24910 intergenic_region ; MODIFIER silent_mutation Average:47.066; most accessible tissue: Callus, score: 81.633 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214284699 NA 6.41E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214284699 NA 1.06E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214284699 2.08E-06 NA mr1361_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214284699 1.31E-06 9.37E-10 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251