\
| Variant ID: vg1214284699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14284699 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )
GGAGTCTCACGTGACGGATTGAAAGCGTTTAAAGTTTAGTGAACTTTTAGTATACATAGTAGATAGATAGATAGATTCCTTCATTCTTTTGTGTTCAGTT[G/A]
GGCTACATAACTATGACCATGATGCTCTATAGTATATTTCAGTTCTTCCATTGTTTGTTTTTTTTGCAAAAGTGATGGGGAACGAAAATAAAGAATAGAT
ATCTATTCTTTATTTTCGTTCCCCATCACTTTTGCAAAAAAAACAAACAATGGAAGAACTGAAATATACTATAGAGCATCATGGTCATAGTTATGTAGCC[C/T]
AACTGAACACAAAAGAATGAAGGAATCTATCTATCTATCTACTATGTATACTAAAAGTTCACTAAACTTTAAACGCTTTCAATCCGTCACGTGAGACTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 8.80% | 0.55% | 9.80% | NA |
| All Indica | 2759 | 68.60% | 14.80% | 0.87% | 15.77% | NA |
| All Japonica | 1512 | 97.60% | 0.50% | 0.07% | 1.85% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.60% | 42.40% | 0.50% | 0.50% | NA |
| Indica II | 465 | 66.20% | 4.50% | 2.15% | 27.10% | NA |
| Indica III | 913 | 74.60% | 3.60% | 0.44% | 21.36% | NA |
| Indica Intermediate | 786 | 72.10% | 12.80% | 0.89% | 14.12% | NA |
| Temperate Japonica | 767 | 96.10% | 0.30% | 0.13% | 3.52% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214284699 | G -> DEL | N | N | silent_mutation | Average:47.066; most accessible tissue: Callus, score: 81.633 | N | N | N | N |
| vg1214284699 | G -> A | LOC_Os12g24890.1 | upstream_gene_variant ; 4022.0bp to feature; MODIFIER | silent_mutation | Average:47.066; most accessible tissue: Callus, score: 81.633 | N | N | N | N |
| vg1214284699 | G -> A | LOC_Os12g24900.1 | downstream_gene_variant ; 2135.0bp to feature; MODIFIER | silent_mutation | Average:47.066; most accessible tissue: Callus, score: 81.633 | N | N | N | N |
| vg1214284699 | G -> A | LOC_Os12g24900-LOC_Os12g24910 | intergenic_region ; MODIFIER | silent_mutation | Average:47.066; most accessible tissue: Callus, score: 81.633 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214284699 | NA | 6.41E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214284699 | NA | 1.06E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214284699 | 2.08E-06 | NA | mr1361_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214284699 | 1.31E-06 | 9.37E-10 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |