\
| Variant ID: vg1214273942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14273942 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )
TGGTGCCCCGCAATGAATCATGCTATGCAAAAGGTAAAGCTGTTGCCCATGCTGGCTTGTGGTTGGCACGGTTAATGTTTCACAACCGAAAATCGTGAAC[C/T]
GGTCCTTAATTGTCATGAGCACTACCATCAAAACCATGTGCTCACAACCCACCATTATCAAGTTTTAGTTGGCACATTAATTAATTAACCAATCACGATA
TATCGTGATTGGTTAATTAATTAATGTGCCAACTAAAACTTGATAATGGTGGGTTGTGAGCACATGGTTTTGATGGTAGTGCTCATGACAATTAAGGACC[G/A]
GTTCACGATTTTCGGTTGTGAAACATTAACCGTGCCAACCACAAGCCAGCATGGGCAACAGCTTTACCTTTTGCATAGCATGATTCATTGCGGGGCACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 26.10% | 3.13% | 14.18% | NA |
| All Indica | 2759 | 30.50% | 41.30% | 5.36% | 22.83% | NA |
| All Japonica | 1512 | 94.00% | 3.70% | 0.00% | 2.31% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.90% | 33.90% | 3.87% | 35.29% | NA |
| Indica II | 465 | 45.80% | 23.40% | 3.66% | 27.10% | NA |
| Indica III | 913 | 21.40% | 56.70% | 7.23% | 14.68% | NA |
| Indica Intermediate | 786 | 34.90% | 39.40% | 5.34% | 20.36% | NA |
| Temperate Japonica | 767 | 96.00% | 0.30% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 89.30% | 10.10% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 22.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214273942 | C -> DEL | N | N | silent_mutation | Average:24.75; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg1214273942 | C -> T | LOC_Os12g24880-LOC_Os12g24890 | intergenic_region ; MODIFIER | silent_mutation | Average:24.75; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214273942 | NA | 1.29E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 7.26E-06 | mr1558 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 9.78E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 4.67E-06 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 3.75E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 7.54E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | 3.48E-06 | 7.67E-09 | mr1422_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | NA | 1.52E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214273942 | 7.15E-07 | 5.21E-14 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |