\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214199203:

Variant ID: vg1214199203 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14199203
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CAGATGGTTTTGGTCCCACGTTAAAATTCCAACTGAGCTACCGGGAATCTGCAAAACAAGCCACGTATCTCATCCAATCCGAATCCGATTTGGGTTTTGG[G/A]
CTTTGTAATTGTGTCGTGGGCTTAGCCTAAGGGGGTGTGCGCCCTTGGGAAACCCTAGGACGTCCCTAATCACATTTATTCAGTAGCCGTCAACGTTTAG

Reverse complement sequence

CTAAACGTTGACGGCTACTGAATAAATGTGATTAGGGACGTCCTAGGGTTTCCCAAGGGCGCACACCCCCTTAGGCTAAGCCCACGACACAATTACAAAG[C/T]
CCAAAACCCAAATCGGATTCGGATTGGATGAGATACGTGGCTTGTTTTGCAGATTCCCGGTAGCTCAGTTGGAATTTTAACGTGGGACCAAAACCATCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 4.70% 0.51% 0.00% NA
All Indica  2759 98.00% 1.80% 0.14% 0.00% NA
All Japonica  1512 87.80% 10.80% 1.32% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.60% 4.50% 0.86% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 86.70% 10.80% 2.48% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.40% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214199203 G -> A LOC_Os12g24750.1 upstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1214199203 G -> A LOC_Os12g24760.1 upstream_gene_variant ; 4006.0bp to feature; MODIFIER silent_mutation Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1214199203 G -> A LOC_Os12g24740.1 downstream_gene_variant ; 4378.0bp to feature; MODIFIER silent_mutation Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1214199203 G -> A LOC_Os12g24740-LOC_Os12g24750 intergenic_region ; MODIFIER silent_mutation Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214199203 NA 4.20E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 2.79E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 2.40E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 2.02E-07 2.19E-07 mr1204_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 5.27E-06 1.26E-07 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 4.29E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 6.95E-06 NA mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 2.99E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 8.14E-06 1.33E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 3.52E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 2.88E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 6.60E-06 6.60E-06 mr1356_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 4.14E-06 4.14E-06 mr1365_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 4.19E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 1.44E-06 1.44E-06 mr1413_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 1.87E-06 1.86E-06 mr1569_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 2.32E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 6.51E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203 NA 9.31E-06 mr1912_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251