Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214199203:

Variant ID: vg1214199203 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14199203
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CAGATGGTTTTGGTCCCACGTTAAAATTCCAACTGAGCTACCGGGAATCTGCAAAACAAGCCACGTATCTCATCCAATCCGAATCCGATTTGGGTTTTGG[G/A]
CTTTGTAATTGTGTCGTGGGCTTAGCCTAAGGGGGTGTGCGCCCTTGGGAAACCCTAGGACGTCCCTAATCACATTTATTCAGTAGCCGTCAACGTTTAG

Reverse complement sequence

CTAAACGTTGACGGCTACTGAATAAATGTGATTAGGGACGTCCTAGGGTTTCCCAAGGGCGCACACCCCCTTAGGCTAAGCCCACGACACAATTACAAAG[C/T]
CCAAAACCCAAATCGGATTCGGATTGGATGAGATACGTGGCTTGTTTTGCAGATTCCCGGTAGCTCAGTTGGAATTTTAACGTGGGACCAAAACCATCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	4.70%	0.51%	0.00%	NA
All Indica	2759	98.00%	1.80%	0.14%	0.00%	NA
All Japonica	1512	87.80%	10.80%	1.32%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.60%	4.50%	0.86%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	86.70%	10.80%	2.48%	0.00%	NA
Tropical Japonica	504	88.90%	11.10%	0.00%	0.00%	NA
Japonica Intermediate	241	89.20%	10.40%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214199203	G -> A	LOC_Os12g24750.1	upstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1214199203	G -> A	LOC_Os12g24760.1	upstream_gene_variant ; 4006.0bp to feature; MODIFIER	silent_mutation	Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1214199203	G -> A	LOC_Os12g24740.1	downstream_gene_variant ; 4378.0bp to feature; MODIFIER	silent_mutation	Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1214199203	G -> A	LOC_Os12g24740-LOC_Os12g24750	intergenic_region ; MODIFIER	silent_mutation	Average:30.495; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214199203	NA	4.20E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	2.79E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	2.40E-06	mr1185_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	2.02E-07	2.19E-07	mr1204_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	5.27E-06	1.26E-07	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	4.29E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	6.95E-06	NA	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	2.99E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	8.14E-06	1.33E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	3.52E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	2.88E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	6.60E-06	6.60E-06	mr1356_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	4.14E-06	4.14E-06	mr1365_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	4.19E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	1.44E-06	1.44E-06	mr1413_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	1.87E-06	1.86E-06	mr1569_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	2.32E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	6.51E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214199203	NA	9.31E-06	mr1912_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251