Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214192780:

Variant ID: vg1214192780 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14192780
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AGTATGTTTTCAGAGTGCAGAGTTGTGCATTGATTCATATCTAGTCCTTAGTGTTGTCGGTTGCTTGCTTGAGCTAGAGTTGAGTCTAGGCTAGGCCAGC[A/T]
CATTGACTAGTACTTTGAACTATTATTCAACTTTGCATTTTTTGATTAGCACAATTGCGTCCCTTTGCTACTATATACTGTGCCTCCCAAGCTCCACATA

Reverse complement sequence

TATGTGGAGCTTGGGAGGCACAGTATATAGTAGCAAAGGGACGCAATTGTGCTAATCAAAAAATGCAAAGTTGAATAATAGTTCAAAGTACTAGTCAATG[T/A]
GCTGGCCTAGCCTAGACTCAACTCTAGCTCAAGCAAGCAACCGACAACACTAAGGACTAGATATGAATCAATGCACAACTCTGCACTCTGAAAACATACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	12.40%	0.99%	0.63%	NA
All Indica	2759	96.80%	3.20%	0.04%	0.00%	NA
All Japonica	1512	67.00%	28.20%	2.91%	1.92%	NA
Aus	269	82.50%	17.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	88.40%	11.40%	0.22%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	87.50%	12.30%	0.13%	0.13%	NA
Tropical Japonica	504	36.30%	51.20%	7.74%	4.76%	NA
Japonica Intermediate	241	66.00%	30.70%	1.66%	1.66%	NA
VI/Aromatic	96	86.50%	11.50%	2.08%	0.00%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214192780	A -> DEL	N	N	silent_mutation	Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1214192780	A -> T	LOC_Os12g24730.1	upstream_gene_variant ; 4376.0bp to feature; MODIFIER	silent_mutation	Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1214192780	A -> T	LOC_Os12g24740.1	upstream_gene_variant ; 326.0bp to feature; MODIFIER	silent_mutation	Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg1214192780	A -> T	LOC_Os12g24730-LOC_Os12g24740	intergenic_region ; MODIFIER	silent_mutation	Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214192780	2.71E-07	1.50E-11	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780	NA	1.73E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780	NA	1.27E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780	1.63E-07	1.63E-07	mr1605	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780	NA	1.79E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780	3.29E-06	3.28E-06	mr1856	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251