\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214192780:

Variant ID: vg1214192780 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14192780
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATGTTTTCAGAGTGCAGAGTTGTGCATTGATTCATATCTAGTCCTTAGTGTTGTCGGTTGCTTGCTTGAGCTAGAGTTGAGTCTAGGCTAGGCCAGC[A/T]
CATTGACTAGTACTTTGAACTATTATTCAACTTTGCATTTTTTGATTAGCACAATTGCGTCCCTTTGCTACTATATACTGTGCCTCCCAAGCTCCACATA

Reverse complement sequence

TATGTGGAGCTTGGGAGGCACAGTATATAGTAGCAAAGGGACGCAATTGTGCTAATCAAAAAATGCAAAGTTGAATAATAGTTCAAAGTACTAGTCAATG[T/A]
GCTGGCCTAGCCTAGACTCAACTCTAGCTCAAGCAAGCAACCGACAACACTAAGGACTAGATATGAATCAATGCACAACTCTGCACTCTGAAAACATACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 12.40% 0.99% 0.63% NA
All Indica  2759 96.80% 3.20% 0.04% 0.00% NA
All Japonica  1512 67.00% 28.20% 2.91% 1.92% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 88.40% 11.40% 0.22% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 87.50% 12.30% 0.13% 0.13% NA
Tropical Japonica  504 36.30% 51.20% 7.74% 4.76% NA
Japonica Intermediate  241 66.00% 30.70% 1.66% 1.66% NA
VI/Aromatic  96 86.50% 11.50% 2.08% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214192780 A -> DEL N N silent_mutation Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1214192780 A -> T LOC_Os12g24730.1 upstream_gene_variant ; 4376.0bp to feature; MODIFIER silent_mutation Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1214192780 A -> T LOC_Os12g24740.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg1214192780 A -> T LOC_Os12g24730-LOC_Os12g24740 intergenic_region ; MODIFIER silent_mutation Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214192780 2.71E-07 1.50E-11 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780 NA 1.73E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780 NA 1.27E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780 1.63E-07 1.63E-07 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780 NA 1.79E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214192780 3.29E-06 3.28E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251