\
| Variant ID: vg1214192780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14192780 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 281. )
AGTATGTTTTCAGAGTGCAGAGTTGTGCATTGATTCATATCTAGTCCTTAGTGTTGTCGGTTGCTTGCTTGAGCTAGAGTTGAGTCTAGGCTAGGCCAGC[A/T]
CATTGACTAGTACTTTGAACTATTATTCAACTTTGCATTTTTTGATTAGCACAATTGCGTCCCTTTGCTACTATATACTGTGCCTCCCAAGCTCCACATA
TATGTGGAGCTTGGGAGGCACAGTATATAGTAGCAAAGGGACGCAATTGTGCTAATCAAAAAATGCAAAGTTGAATAATAGTTCAAAGTACTAGTCAATG[T/A]
GCTGGCCTAGCCTAGACTCAACTCTAGCTCAAGCAAGCAACCGACAACACTAAGGACTAGATATGAATCAATGCACAACTCTGCACTCTGAAAACATACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 12.40% | 0.99% | 0.63% | NA |
| All Indica | 2759 | 96.80% | 3.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 67.00% | 28.20% | 2.91% | 1.92% | NA |
| Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.40% | 11.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.50% | 12.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 36.30% | 51.20% | 7.74% | 4.76% | NA |
| Japonica Intermediate | 241 | 66.00% | 30.70% | 1.66% | 1.66% | NA |
| VI/Aromatic | 96 | 86.50% | 11.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214192780 | A -> DEL | N | N | silent_mutation | Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1214192780 | A -> T | LOC_Os12g24730.1 | upstream_gene_variant ; 4376.0bp to feature; MODIFIER | silent_mutation | Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1214192780 | A -> T | LOC_Os12g24740.1 | upstream_gene_variant ; 326.0bp to feature; MODIFIER | silent_mutation | Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1214192780 | A -> T | LOC_Os12g24730-LOC_Os12g24740 | intergenic_region ; MODIFIER | silent_mutation | Average:32.901; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214192780 | 2.71E-07 | 1.50E-11 | mr1408 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214192780 | NA | 1.73E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214192780 | NA | 1.27E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214192780 | 1.63E-07 | 1.63E-07 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214192780 | NA | 1.79E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214192780 | 3.29E-06 | 3.28E-06 | mr1856 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |