\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214147913:

Variant ID: vg1214147913 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14147913
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATATCTAGCCTCGAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCTGGT[G/A]
GGTCAATATGTTCTGCTAGGGGCCGCTGTTGACGCGTGGACCGAAAAGGAGTTTTTGGGTTACAGCCGAGTATAATGAACCTACAGGGTCGCAAGCTTGA

Reverse complement sequence

TCAAGCTTGCGACCCTGTAGGTTCATTATACTCGGCTGTAACCCAAAAACTCCTTTTCGGTCCACGCGTCAACAGCGGCCCCTAGCAGAACATATTGACC[C/T]
ACCAGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTCGAGGCTAGATATGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 0.80% 2.92% 1.80% NA
All Indica  2759 97.70% 0.20% 1.52% 0.54% NA
All Japonica  1512 87.50% 1.90% 6.15% 4.43% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 97.00% 0.20% 1.51% 1.34% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.50% 0.20% 0.88% 0.44% NA
Indica Intermediate  786 96.20% 0.40% 3.05% 0.38% NA
Temperate Japonica  767 94.80% 0.40% 2.87% 1.96% NA
Tropical Japonica  504 83.10% 4.40% 7.94% 4.56% NA
Japonica Intermediate  241 73.40% 1.70% 12.86% 12.03% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214147913 G -> DEL N N silent_mutation Average:14.672; most accessible tissue: Callus, score: 22.433 N N N N
vg1214147913 G -> A LOC_Os12g24690.1 upstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:14.672; most accessible tissue: Callus, score: 22.433 N N N N
vg1214147913 G -> A LOC_Os12g24680-LOC_Os12g24690 intergenic_region ; MODIFIER silent_mutation Average:14.672; most accessible tissue: Callus, score: 22.433 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214147913 NA 2.04E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 NA 7.78E-10 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 1.29E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 3.67E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 5.94E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 2.12E-08 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 NA 3.64E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 8.01E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 5.16E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147913 NA 4.26E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251