\
| Variant ID: vg1214147913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14147913 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACATATCTAGCCTCGAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCTGGT[G/A]
GGTCAATATGTTCTGCTAGGGGCCGCTGTTGACGCGTGGACCGAAAAGGAGTTTTTGGGTTACAGCCGAGTATAATGAACCTACAGGGTCGCAAGCTTGA
TCAAGCTTGCGACCCTGTAGGTTCATTATACTCGGCTGTAACCCAAAAACTCCTTTTCGGTCCACGCGTCAACAGCGGCCCCTAGCAGAACATATTGACC[C/T]
ACCAGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTCGAGGCTAGATATGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 0.80% | 2.92% | 1.80% | NA |
| All Indica | 2759 | 97.70% | 0.20% | 1.52% | 0.54% | NA |
| All Japonica | 1512 | 87.50% | 1.90% | 6.15% | 4.43% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.00% | 0.20% | 1.51% | 1.34% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.50% | 0.20% | 0.88% | 0.44% | NA |
| Indica Intermediate | 786 | 96.20% | 0.40% | 3.05% | 0.38% | NA |
| Temperate Japonica | 767 | 94.80% | 0.40% | 2.87% | 1.96% | NA |
| Tropical Japonica | 504 | 83.10% | 4.40% | 7.94% | 4.56% | NA |
| Japonica Intermediate | 241 | 73.40% | 1.70% | 12.86% | 12.03% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214147913 | G -> DEL | N | N | silent_mutation | Average:14.672; most accessible tissue: Callus, score: 22.433 | N | N | N | N |
| vg1214147913 | G -> A | LOC_Os12g24690.1 | upstream_gene_variant ; 1545.0bp to feature; MODIFIER | silent_mutation | Average:14.672; most accessible tissue: Callus, score: 22.433 | N | N | N | N |
| vg1214147913 | G -> A | LOC_Os12g24680-LOC_Os12g24690 | intergenic_region ; MODIFIER | silent_mutation | Average:14.672; most accessible tissue: Callus, score: 22.433 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214147913 | NA | 2.04E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | NA | 7.78E-10 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 1.29E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 3.67E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 5.94E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 2.12E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | NA | 3.64E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 8.01E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | 5.16E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147913 | NA | 4.26E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |