Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214140716:

Variant ID: vg1214140716 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14140716
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AATACTGGCTTCGGCTAACAGGATGTAGGGTTATTACCTGATAATTCAGGGGCTCGAACCTGTATAAAAATCCTTGTCTTCATCTCTTTTACCTCAGTCT[C/T]
GCGTATATCCTAGTACCAACGATCCCCATAGTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGTGGCGCGTCAGGTAGGGGGATTTTTGGTGCT

Reverse complement sequence

AGCACCAAAAATCCCCCTACCTGACGCGCCACTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATACTATGGGGATCGTTGGTACTAGGATATACGC[G/A]
AGACTGAGGTAAAAGAGATGAAGACAAGGATTTTTATACAGGTTCGAGCCCCTGAATTATCAGGTAATAACCCTACATCCTGTTAGCCGAAGCCAGTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	4.50%	4.13%	17.46%	NA
All Indica	2759	77.70%	3.10%	1.99%	17.25%	NA
All Japonica	1512	64.40%	7.50%	8.53%	19.51%	NA
Aus	269	83.30%	3.00%	1.49%	12.27%	NA
Indica I	595	99.00%	0.20%	0.00%	0.84%	NA
Indica II	465	54.40%	6.90%	4.52%	34.19%	NA
Indica III	913	74.90%	3.30%	1.97%	19.82%	NA
Indica Intermediate	786	78.50%	2.80%	2.04%	16.67%	NA
Temperate Japonica	767	82.50%	3.90%	4.95%	8.60%	NA
Tropical Japonica	504	36.90%	12.70%	13.49%	36.90%	NA
Japonica Intermediate	241	64.30%	8.30%	9.54%	17.84%	NA
VI/Aromatic	96	85.40%	1.00%	2.08%	11.46%	NA
Intermediate	90	76.70%	6.70%	5.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214140716	C -> DEL	N	N	silent_mutation	Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1214140716	C -> T	LOC_Os12g24680.1	downstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1214140716	C -> T	LOC_Os12g24680-LOC_Os12g24690	intergenic_region ; MODIFIER	silent_mutation	Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214140716	1.93E-06	8.16E-08	mr1024	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	8.35E-06	NA	mr1284	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	8.27E-06	8.26E-06	mr1601	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	NA	3.01E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	8.53E-06	NA	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	2.68E-06	2.68E-06	mr1856	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716	NA	5.86E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251