\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214140716:

Variant ID: vg1214140716 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14140716
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AATACTGGCTTCGGCTAACAGGATGTAGGGTTATTACCTGATAATTCAGGGGCTCGAACCTGTATAAAAATCCTTGTCTTCATCTCTTTTACCTCAGTCT[C/T]
GCGTATATCCTAGTACCAACGATCCCCATAGTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGTGGCGCGTCAGGTAGGGGGATTTTTGGTGCT

Reverse complement sequence

AGCACCAAAAATCCCCCTACCTGACGCGCCACTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATACTATGGGGATCGTTGGTACTAGGATATACGC[G/A]
AGACTGAGGTAAAAGAGATGAAGACAAGGATTTTTATACAGGTTCGAGCCCCTGAATTATCAGGTAATAACCCTACATCCTGTTAGCCGAAGCCAGTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 4.50% 4.13% 17.46% NA
All Indica  2759 77.70% 3.10% 1.99% 17.25% NA
All Japonica  1512 64.40% 7.50% 8.53% 19.51% NA
Aus  269 83.30% 3.00% 1.49% 12.27% NA
Indica I  595 99.00% 0.20% 0.00% 0.84% NA
Indica II  465 54.40% 6.90% 4.52% 34.19% NA
Indica III  913 74.90% 3.30% 1.97% 19.82% NA
Indica Intermediate  786 78.50% 2.80% 2.04% 16.67% NA
Temperate Japonica  767 82.50% 3.90% 4.95% 8.60% NA
Tropical Japonica  504 36.90% 12.70% 13.49% 36.90% NA
Japonica Intermediate  241 64.30% 8.30% 9.54% 17.84% NA
VI/Aromatic  96 85.40% 1.00% 2.08% 11.46% NA
Intermediate  90 76.70% 6.70% 5.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214140716 C -> DEL N N silent_mutation Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1214140716 C -> T LOC_Os12g24680.1 downstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N
vg1214140716 C -> T LOC_Os12g24680-LOC_Os12g24690 intergenic_region ; MODIFIER silent_mutation Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214140716 1.93E-06 8.16E-08 mr1024 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 8.35E-06 NA mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 8.27E-06 8.26E-06 mr1601 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 NA 3.01E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 8.53E-06 NA mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 2.68E-06 2.68E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214140716 NA 5.86E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251