\
| Variant ID: vg1214140716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14140716 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )
AATACTGGCTTCGGCTAACAGGATGTAGGGTTATTACCTGATAATTCAGGGGCTCGAACCTGTATAAAAATCCTTGTCTTCATCTCTTTTACCTCAGTCT[C/T]
GCGTATATCCTAGTACCAACGATCCCCATAGTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGTGGCGCGTCAGGTAGGGGGATTTTTGGTGCT
AGCACCAAAAATCCCCCTACCTGACGCGCCACTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATACTATGGGGATCGTTGGTACTAGGATATACGC[G/A]
AGACTGAGGTAAAAGAGATGAAGACAAGGATTTTTATACAGGTTCGAGCCCCTGAATTATCAGGTAATAACCCTACATCCTGTTAGCCGAAGCCAGTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 4.50% | 4.13% | 17.46% | NA |
| All Indica | 2759 | 77.70% | 3.10% | 1.99% | 17.25% | NA |
| All Japonica | 1512 | 64.40% | 7.50% | 8.53% | 19.51% | NA |
| Aus | 269 | 83.30% | 3.00% | 1.49% | 12.27% | NA |
| Indica I | 595 | 99.00% | 0.20% | 0.00% | 0.84% | NA |
| Indica II | 465 | 54.40% | 6.90% | 4.52% | 34.19% | NA |
| Indica III | 913 | 74.90% | 3.30% | 1.97% | 19.82% | NA |
| Indica Intermediate | 786 | 78.50% | 2.80% | 2.04% | 16.67% | NA |
| Temperate Japonica | 767 | 82.50% | 3.90% | 4.95% | 8.60% | NA |
| Tropical Japonica | 504 | 36.90% | 12.70% | 13.49% | 36.90% | NA |
| Japonica Intermediate | 241 | 64.30% | 8.30% | 9.54% | 17.84% | NA |
| VI/Aromatic | 96 | 85.40% | 1.00% | 2.08% | 11.46% | NA |
| Intermediate | 90 | 76.70% | 6.70% | 5.56% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214140716 | C -> DEL | N | N | silent_mutation | Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1214140716 | C -> T | LOC_Os12g24680.1 | downstream_gene_variant ; 2435.0bp to feature; MODIFIER | silent_mutation | Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| vg1214140716 | C -> T | LOC_Os12g24680-LOC_Os12g24690 | intergenic_region ; MODIFIER | silent_mutation | Average:54.453; most accessible tissue: Zhenshan97 flag leaf, score: 86.115 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214140716 | 1.93E-06 | 8.16E-08 | mr1024 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | 8.35E-06 | NA | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | 8.27E-06 | 8.26E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | NA | 3.01E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | 8.53E-06 | NA | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | 2.68E-06 | 2.68E-06 | mr1856 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214140716 | NA | 5.86E-07 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |