\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214071883:

Variant ID: vg1214071883 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14071883
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTTTTCGATGGAATGGATTTTTCTCATTGGTATAGTAGGATGCAATCTTACATTATGGCTGAAGATTATGATATTTGGAGAAAAGTTTCTCATCCTT[G/A]
TGTGATTCCTGAAGTTATTAATACTGCTGCTGCAAAAACTGAGTTTGAACAAAATTGCAAAGCTCGCAATATTCTTTTGAATGGGATTTCTCGTTCGGAT

Reverse complement sequence

ATCCGAACGAGAAATCCCATTCAAAAGAATATTGCGAGCTTTGCAATTTTGTTCAAACTCAGTTTTTGCAGCAGCAGTATTAATAACTTCAGGAATCACA[C/T]
AAGGATGAGAAACTTTTCTCCAAATATCATAATCTTCAGCCATAATGTAAGATTGCATCCTACTATACCAATGAGAAAAATCCATTCCATCGAAAACATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.40% 0.19% 0.00% NA
All Indica  2759 75.50% 24.30% 0.18% 0.00% NA
All Japonica  1512 20.40% 79.60% 0.07% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 65.40% 34.60% 0.00% 0.00% NA
Indica II  465 74.80% 24.90% 0.22% 0.00% NA
Indica III  913 83.00% 17.00% 0.00% 0.00% NA
Indica Intermediate  786 74.90% 24.60% 0.51% 0.00% NA
Temperate Japonica  767 11.10% 88.90% 0.00% 0.00% NA
Tropical Japonica  504 25.20% 74.60% 0.20% 0.00% NA
Japonica Intermediate  241 39.80% 60.20% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 33.30% 63.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214071883 G -> A LOC_Os12g24600.1 upstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:23.861; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N
vg1214071883 G -> A LOC_Os12g24590-LOC_Os12g24600 intergenic_region ; MODIFIER silent_mutation Average:23.861; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214071883 NA 5.83E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 3.96E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.03E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 5.60E-16 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 6.78E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.57E-16 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.65E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.57E-14 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 3.07E-16 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 3.40E-16 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 6.60E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.84E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.98E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 9.43E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.15E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.07E-20 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.01E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 5.44E-20 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 8.75E-20 mr1031_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 8.97E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.16E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 5.43E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.29E-17 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 1.45E-15 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883 NA 2.47E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251