Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214071883:

Variant ID: vg1214071883 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14071883
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTTTTCGATGGAATGGATTTTTCTCATTGGTATAGTAGGATGCAATCTTACATTATGGCTGAAGATTATGATATTTGGAGAAAAGTTTCTCATCCTT[G/A]
TGTGATTCCTGAAGTTATTAATACTGCTGCTGCAAAAACTGAGTTTGAACAAAATTGCAAAGCTCGCAATATTCTTTTGAATGGGATTTCTCGTTCGGAT

Reverse complement sequence

ATCCGAACGAGAAATCCCATTCAAAAGAATATTGCGAGCTTTGCAATTTTGTTCAAACTCAGTTTTTGCAGCAGCAGTATTAATAACTTCAGGAATCACA[C/T]
AAGGATGAGAAACTTTTCTCCAAATATCATAATCTTCAGCCATAATGTAAGATTGCATCCTACTATACCAATGAGAAAAATCCATTCCATCGAAAACATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	42.40%	0.19%	0.00%	NA
All Indica	2759	75.50%	24.30%	0.18%	0.00%	NA
All Japonica	1512	20.40%	79.60%	0.07%	0.00%	NA
Aus	269	81.40%	18.60%	0.00%	0.00%	NA
Indica I	595	65.40%	34.60%	0.00%	0.00%	NA
Indica II	465	74.80%	24.90%	0.22%	0.00%	NA
Indica III	913	83.00%	17.00%	0.00%	0.00%	NA
Indica Intermediate	786	74.90%	24.60%	0.51%	0.00%	NA
Temperate Japonica	767	11.10%	88.90%	0.00%	0.00%	NA
Tropical Japonica	504	25.20%	74.60%	0.20%	0.00%	NA
Japonica Intermediate	241	39.80%	60.20%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	33.30%	63.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214071883	G -> A	LOC_Os12g24600.1	upstream_gene_variant ; 230.0bp to feature; MODIFIER	silent_mutation	Average:23.861; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg1214071883	G -> A	LOC_Os12g24590-LOC_Os12g24600	intergenic_region ; MODIFIER	silent_mutation	Average:23.861; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214071883	NA	5.83E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	3.96E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.03E-16	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	5.60E-16	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	6.78E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.57E-16	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.65E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.57E-14	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	3.07E-16	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	3.40E-16	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	6.60E-16	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.84E-15	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.98E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	9.43E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.15E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.07E-20	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.01E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	5.44E-20	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	8.75E-20	mr1031_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	8.97E-09	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.16E-15	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	5.43E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.29E-17	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	1.45E-15	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214071883	NA	2.47E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251