\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214068891:

Variant ID: vg1214068891 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14068891
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAGCTCCTGTAGGGCCGGTGGTGGAGGCGTGGCTCTCCTCCATGCCGCTGGGCAGGGCCGAGCTGGTCGCGTGCAGCCTGCCAGCAGCTTGTTGTAGT[G/T]
GACGCCAGTTACAAATTGGCTCCAAATCCAAAAGGCTCAGGGCGTCCCATTCCGAGCACGCGGAGAACGGCTTGCAACGGATAATCAATCCTAAATTTCT

Reverse complement sequence

AGAAATTTAGGATTGATTATCCGTTGCAAGCCGTTCTCCGCGTGCTCGGAATGGGACGCCCTGAGCCTTTTGGATTTGGAGCCAATTTGTAACTGGCGTC[C/A]
ACTACAACAAGCTGCTGGCAGGCTGCACGCGACCAGCTCGGCCCTGCCCAGCGGCATGGAGGAGAGCCACGCCTCCACCACCGGCCCTACAGGAGCTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 19.50% 1.78% 2.96% NA
All Indica  2759 79.80% 13.30% 2.21% 4.71% NA
All Japonica  1512 68.10% 30.40% 1.19% 0.33% NA
Aus  269 82.50% 17.10% 0.37% 0.00% NA
Indica I  595 67.10% 25.00% 4.37% 3.53% NA
Indica II  465 84.90% 6.20% 1.51% 7.31% NA
Indica III  913 85.50% 8.00% 1.42% 5.04% NA
Indica Intermediate  786 79.60% 14.80% 1.91% 3.69% NA
Temperate Japonica  767 88.10% 11.90% 0.00% 0.00% NA
Tropical Japonica  504 38.50% 57.70% 2.78% 0.99% NA
Japonica Intermediate  241 66.00% 32.40% 1.66% 0.00% NA
VI/Aromatic  96 75.00% 24.00% 0.00% 1.04% NA
Intermediate  90 63.30% 27.80% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214068891 G -> DEL N N silent_mutation Average:66.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg1214068891 G -> T LOC_Os12g24600.1 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:66.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg1214068891 G -> T LOC_Os12g24590.1 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:66.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg1214068891 G -> T LOC_Os12g24590-LOC_Os12g24600 intergenic_region ; MODIFIER silent_mutation Average:66.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214068891 G T 0.03 -0.01 0.0 0.03 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214068891 NA 2.51E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 NA 8.12E-08 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 1.22E-06 NA mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 2.20E-06 NA mr1314 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 NA 4.60E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 2.75E-06 2.75E-06 mr1710 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 7.67E-06 NA mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214068891 NA 9.81E-06 mr1825 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251