\
| Variant ID: vg1214046223 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 14046223 |
| Reference Allele: C | Alternative Allele: CGGTCATCTTGTTA,T |
| Primary Allele: C | Secondary Allele: CGGTCATCTTGTTA |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )
CTATCAGAGAATAACAGCGGGAGACAAAATAATATAAGGGCCCGGTTGACATGCCACGAGCAGTCGACTAGGGAACGAGACCTAGAACGAAACCACACTC[C/CGGTCATCTTGTTA,T]
GGTCATCTTGTTAGGTATGCAAGCATACTAACAAGGGCTTCTCTTCAACACTCTGCTAAAAGATATATATATAGAGCAACAATGAGTACAAAAGTACTTA
TAAGTACTTTTGTACTCATTGTTGCTCTATATATATATCTTTTAGCAGAGTGTTGAAGAGAAGCCCTTGTTAGTATGCTTGCATACCTAACAAGATGACC[G/TAACAAGATGACCG,A]
GAGTGTGGTTTCGTTCTAGGTCTCGTTCCCTAGTCGACTGCTCGTGGCATGTCAACCGGGCCCTTATATTATTTTGTCTCCCGCTGTTATTCTCTGATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of CGGTCATCTTGTTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 13.60% | 0.76% | 0.00% | T: 1.25% |
| All Indica | 2759 | 96.80% | 3.10% | 0.11% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 62.80% | 31.50% | 1.92% | 0.00% | T: 3.77% |
| Aus | 269 | 82.20% | 17.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.50% | 0.00% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 97.20% | 2.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 87.40% | 9.40% | 1.30% | 0.00% | T: 1.96% |
| Tropical Japonica | 504 | 26.00% | 65.70% | 2.38% | 0.00% | T: 5.95% |
| Japonica Intermediate | 241 | 61.40% | 30.70% | 2.90% | 0.00% | T: 4.98% |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 18.90% | 2.22% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214046223 | C -> CGGTCATCTTGTTA | LOC_Os12g24555.1 | upstream_gene_variant ; 1620.0bp to feature; MODIFIER | silent_mutation | Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1214046223 | C -> CGGTCATCTTGTTA | LOC_Os12g24555-LOC_Os12g24580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1214046223 | C -> T | LOC_Os12g24555.1 | upstream_gene_variant ; 1619.0bp to feature; MODIFIER | silent_mutation | Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1214046223 | C -> T | LOC_Os12g24555-LOC_Os12g24580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.411; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214046223 | NA | 3.38E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | NA | 8.89E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | NA | 6.67E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | NA | 1.22E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | 2.35E-06 | 2.35E-06 | mr1663 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | 9.42E-07 | NA | mr1291_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214046223 | 1.89E-06 | NA | mr1892_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |