\
| Variant ID: vg1214006412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14006412 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACTCATATTGACTAGGCATATTTAAAAAGCTCTATAGGTGACACGTATCATAGGGAAGCGAGGTATAGATTATGTATATCTCCTTCGCATTTATTGAT[C/T]
ATATAAAGTACGTGTAACAAATTACGTCAATATGAACAAATTAGAGAGAGGGCTAGCTTGATAGTACAAATAAACATATTTATTAGCAATAATTGTTTTT
AAAAACAATTATTGCTAATAAATATGTTTATTTGTACTATCAAGCTAGCCCTCTCTCTAATTTGTTCATATTGACGTAATTTGTTACACGTACTTTATAT[G/A]
ATCAATAAATGCGAAGGAGATATACATAATCTATACCTCGCTTCCCTATGATACGTGTCACCTATAGAGCTTTTTAAATATGCCTAGTCAATATGAGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 12.30% | 1.42% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 67.30% | 29.60% | 3.04% | 0.00% | NA |
| Aus | 269 | 83.60% | 14.50% | 1.86% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.30% | 8.80% | 0.86% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 88.90% | 9.40% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 33.50% | 61.30% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.30% | 27.80% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 12.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214006412 | C -> T | LOC_Os12g24530.1 | downstream_gene_variant ; 3604.0bp to feature; MODIFIER | silent_mutation | Average:24.209; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1214006412 | C -> T | LOC_Os12g24519-LOC_Os12g24530 | intergenic_region ; MODIFIER | silent_mutation | Average:24.209; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214006412 | NA | 1.29E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 8.14E-06 | NA | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 8.29E-06 | NA | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 3.56E-06 | NA | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 2.03E-06 | 6.35E-11 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | NA | 7.67E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 2.07E-06 | NA | mr1507 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 8.05E-08 | 8.04E-08 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | NA | 4.50E-06 | mr1653 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | NA | 1.77E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | NA | 6.26E-07 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | NA | 4.04E-06 | mr1731 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 2.95E-06 | NA | mr1809 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 7.28E-07 | 7.25E-07 | mr1856 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214006412 | 8.53E-06 | NA | mr1881 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |