\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214006412:

Variant ID: vg1214006412 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14006412
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACTCATATTGACTAGGCATATTTAAAAAGCTCTATAGGTGACACGTATCATAGGGAAGCGAGGTATAGATTATGTATATCTCCTTCGCATTTATTGAT[C/T]
ATATAAAGTACGTGTAACAAATTACGTCAATATGAACAAATTAGAGAGAGGGCTAGCTTGATAGTACAAATAAACATATTTATTAGCAATAATTGTTTTT

Reverse complement sequence

AAAAACAATTATTGCTAATAAATATGTTTATTTGTACTATCAAGCTAGCCCTCTCTCTAATTTGTTCATATTGACGTAATTTGTTACACGTACTTTATAT[G/A]
ATCAATAAATGCGAAGGAGATATACATAATCTATACCTCGCTTCCCTATGATACGTGTCACCTATAGAGCTTTTTAAATATGCCTAGTCAATATGAGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 12.30% 1.42% 0.00% NA
All Indica  2759 97.20% 2.40% 0.36% 0.00% NA
All Japonica  1512 67.30% 29.60% 3.04% 0.00% NA
Aus  269 83.60% 14.50% 1.86% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 90.30% 8.80% 0.86% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.50% 0.76% 0.00% NA
Temperate Japonica  767 88.90% 9.40% 1.69% 0.00% NA
Tropical Japonica  504 33.50% 61.30% 5.16% 0.00% NA
Japonica Intermediate  241 69.30% 27.80% 2.90% 0.00% NA
VI/Aromatic  96 83.30% 12.50% 4.17% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214006412 C -> T LOC_Os12g24530.1 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:24.209; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1214006412 C -> T LOC_Os12g24519-LOC_Os12g24530 intergenic_region ; MODIFIER silent_mutation Average:24.209; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214006412 NA 1.29E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 8.14E-06 NA mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 8.29E-06 NA mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 3.56E-06 NA mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 2.03E-06 6.35E-11 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 NA 7.67E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 2.07E-06 NA mr1507 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 8.05E-08 8.04E-08 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 NA 4.50E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 NA 1.77E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 NA 6.26E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 NA 4.04E-06 mr1731 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 2.95E-06 NA mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 7.28E-07 7.25E-07 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214006412 8.53E-06 NA mr1881 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251