Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213938357:

Variant ID: vg1213938357 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13938357
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACGCCGCATCCTCCCGAGGCGAGCTCGTCGAGCTTGACGAAGCGGCTTGTGGAGATTATGGATATCCCATATCTACACGGCGATGGTATTTGGGCTGA[A/G]
TACAGGATACCAAATATAGATAGAATATCTTATTTGTGTCTCGGGTTTGTTTCTCAACTTGTACATCAAGGAAATACCTTGAGACTTAGTCGGCTACGAC

Reverse complement sequence

GTCGTAGCCGACTAAGTCTCAAGGTATTTCCTTGATGTACAAGTTGAGAAACAAACCCGAGACACAAATAAGATATTCTATCTATATTTGGTATCCTGTA[T/C]
TCAGCCCAAATACCATCGCCGTGTAGATATGGGATATCCATAATCTCCACAAGCCGCTTCGTCAAGCTCGACGAGCTCGCCTCGGGAGGATGCGGCGTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	0.20%	2.20%	40.16%	NA
All Indica	2759	47.10%	0.20%	2.21%	50.49%	NA
All Japonica	1512	78.60%	0.30%	2.31%	18.78%	NA
Aus	269	46.80%	0.00%	1.86%	51.30%	NA
Indica I	595	41.70%	0.00%	1.51%	56.81%	NA
Indica II	465	48.40%	0.90%	2.15%	48.60%	NA
Indica III	913	47.80%	0.10%	2.63%	49.51%	NA
Indica Intermediate	786	49.70%	0.00%	2.29%	47.96%	NA
Temperate Japonica	767	88.10%	0.00%	0.78%	11.08%	NA
Tropical Japonica	504	71.40%	0.80%	5.16%	22.62%	NA
Japonica Intermediate	241	63.10%	0.40%	1.24%	35.27%	NA
VI/Aromatic	96	37.50%	0.00%	1.04%	61.46%	NA
Intermediate	90	71.10%	0.00%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213938357	A -> DEL	N	N	silent_mutation	Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1213938357	A -> G	LOC_Os12g24420.1	upstream_gene_variant ; 142.0bp to feature; MODIFIER	silent_mutation	Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1213938357	A -> G	LOC_Os12g24430.1	upstream_gene_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1213938357	A -> G	LOC_Os12g24420-LOC_Os12g24430	intergenic_region ; MODIFIER	silent_mutation	Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213938357	7.35E-08	7.35E-08	mr1416_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938357	NA	6.85E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251