\
| Variant ID: vg1213938357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13938357 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGACGCCGCATCCTCCCGAGGCGAGCTCGTCGAGCTTGACGAAGCGGCTTGTGGAGATTATGGATATCCCATATCTACACGGCGATGGTATTTGGGCTGA[A/G]
TACAGGATACCAAATATAGATAGAATATCTTATTTGTGTCTCGGGTTTGTTTCTCAACTTGTACATCAAGGAAATACCTTGAGACTTAGTCGGCTACGAC
GTCGTAGCCGACTAAGTCTCAAGGTATTTCCTTGATGTACAAGTTGAGAAACAAACCCGAGACACAAATAAGATATTCTATCTATATTTGGTATCCTGTA[T/C]
TCAGCCCAAATACCATCGCCGTGTAGATATGGGATATCCATAATCTCCACAAGCCGCTTCGTCAAGCTCGACGAGCTCGCCTCGGGAGGATGCGGCGTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 0.20% | 2.20% | 40.16% | NA |
| All Indica | 2759 | 47.10% | 0.20% | 2.21% | 50.49% | NA |
| All Japonica | 1512 | 78.60% | 0.30% | 2.31% | 18.78% | NA |
| Aus | 269 | 46.80% | 0.00% | 1.86% | 51.30% | NA |
| Indica I | 595 | 41.70% | 0.00% | 1.51% | 56.81% | NA |
| Indica II | 465 | 48.40% | 0.90% | 2.15% | 48.60% | NA |
| Indica III | 913 | 47.80% | 0.10% | 2.63% | 49.51% | NA |
| Indica Intermediate | 786 | 49.70% | 0.00% | 2.29% | 47.96% | NA |
| Temperate Japonica | 767 | 88.10% | 0.00% | 0.78% | 11.08% | NA |
| Tropical Japonica | 504 | 71.40% | 0.80% | 5.16% | 22.62% | NA |
| Japonica Intermediate | 241 | 63.10% | 0.40% | 1.24% | 35.27% | NA |
| VI/Aromatic | 96 | 37.50% | 0.00% | 1.04% | 61.46% | NA |
| Intermediate | 90 | 71.10% | 0.00% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213938357 | A -> DEL | N | N | silent_mutation | Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1213938357 | A -> G | LOC_Os12g24420.1 | upstream_gene_variant ; 142.0bp to feature; MODIFIER | silent_mutation | Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1213938357 | A -> G | LOC_Os12g24430.1 | upstream_gene_variant ; 438.0bp to feature; MODIFIER | silent_mutation | Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1213938357 | A -> G | LOC_Os12g24420-LOC_Os12g24430 | intergenic_region ; MODIFIER | silent_mutation | Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213938357 | 7.35E-08 | 7.35E-08 | mr1416_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213938357 | NA | 6.85E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |