\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213938357:

Variant ID: vg1213938357 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13938357
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACGCCGCATCCTCCCGAGGCGAGCTCGTCGAGCTTGACGAAGCGGCTTGTGGAGATTATGGATATCCCATATCTACACGGCGATGGTATTTGGGCTGA[A/G]
TACAGGATACCAAATATAGATAGAATATCTTATTTGTGTCTCGGGTTTGTTTCTCAACTTGTACATCAAGGAAATACCTTGAGACTTAGTCGGCTACGAC

Reverse complement sequence

GTCGTAGCCGACTAAGTCTCAAGGTATTTCCTTGATGTACAAGTTGAGAAACAAACCCGAGACACAAATAAGATATTCTATCTATATTTGGTATCCTGTA[T/C]
TCAGCCCAAATACCATCGCCGTGTAGATATGGGATATCCATAATCTCCACAAGCCGCTTCGTCAAGCTCGACGAGCTCGCCTCGGGAGGATGCGGCGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 0.20% 2.20% 40.16% NA
All Indica  2759 47.10% 0.20% 2.21% 50.49% NA
All Japonica  1512 78.60% 0.30% 2.31% 18.78% NA
Aus  269 46.80% 0.00% 1.86% 51.30% NA
Indica I  595 41.70% 0.00% 1.51% 56.81% NA
Indica II  465 48.40% 0.90% 2.15% 48.60% NA
Indica III  913 47.80% 0.10% 2.63% 49.51% NA
Indica Intermediate  786 49.70% 0.00% 2.29% 47.96% NA
Temperate Japonica  767 88.10% 0.00% 0.78% 11.08% NA
Tropical Japonica  504 71.40% 0.80% 5.16% 22.62% NA
Japonica Intermediate  241 63.10% 0.40% 1.24% 35.27% NA
VI/Aromatic  96 37.50% 0.00% 1.04% 61.46% NA
Intermediate  90 71.10% 0.00% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213938357 A -> DEL N N silent_mutation Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213938357 A -> G LOC_Os12g24420.1 upstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213938357 A -> G LOC_Os12g24430.1 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213938357 A -> G LOC_Os12g24420-LOC_Os12g24430 intergenic_region ; MODIFIER silent_mutation Average:36.168; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213938357 7.35E-08 7.35E-08 mr1416_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938357 NA 6.85E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251