\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213935504:

Variant ID: vg1213935504 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13935504
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTTACTACTCAGATATATAGTCTTGTTTAGGTTCACAACTAGTTTCAGGAAACTGGGTGTTCAGGTATTAAATGACAAAAAATATAATCTGTTGTGCT[G/T]
AATTAATTTTTCCTCTAGTCTCAGGAGAGGCACTGGCGTGTGGGTTTGGCAAAAAAGAAAGCTGAAAGGAGTTGATATTACTCGAGGTATTTGAGAAAAA

Reverse complement sequence

TTTTTCTCAAATACCTCGAGTAATATCAACTCCTTTCAGCTTTCTTTTTTGCCAAACCCACACGCCAGTGCCTCTCCTGAGACTAGAGGAAAAATTAATT[C/A]
AGCACAACAGATTATATTTTTTGTCATTTAATACCTGAACACCCAGTTTCCTGAAACTAGTTGTGAACCTAAACAAGACTATATATCTGAGTAGTAACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 3.30% 9.12% 0.00% NA
All Indica  2759 97.00% 0.40% 2.61% 0.00% NA
All Japonica  1512 70.50% 8.90% 20.57% 0.00% NA
Aus  269 85.90% 2.20% 11.90% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 90.10% 1.10% 8.82% 0.00% NA
Indica III  913 97.90% 0.30% 1.75% 0.00% NA
Indica Intermediate  786 98.00% 0.30% 1.78% 0.00% NA
Temperate Japonica  767 89.60% 5.90% 4.56% 0.00% NA
Tropical Japonica  504 42.30% 10.90% 46.83% 0.00% NA
Japonica Intermediate  241 68.90% 14.50% 16.60% 0.00% NA
VI/Aromatic  96 88.50% 5.20% 6.25% 0.00% NA
Intermediate  90 87.80% 1.10% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213935504 G -> T LOC_Os12g24410.1 upstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:36.062; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213935504 G -> T LOC_Os12g24430.1 upstream_gene_variant ; 3291.0bp to feature; MODIFIER silent_mutation Average:36.062; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213935504 G -> T LOC_Os12g24420.1 downstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:36.062; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg1213935504 G -> T LOC_Os12g24410-LOC_Os12g24420 intergenic_region ; MODIFIER silent_mutation Average:36.062; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213935504 9.69E-06 7.88E-07 mr1058 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 9.98E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 3.95E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 2.65E-06 NA mr1084 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 6.66E-07 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 1.70E-06 NA mr1205 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 1.86E-06 NA mr1206 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 8.02E-06 NA mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 2.49E-06 NA mr1293 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 1.23E-06 3.73E-06 mr1293 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 6.23E-06 3.39E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 3.45E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 3.87E-06 3.87E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 4.92E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 2.21E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 3.00E-06 mr1731 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 3.53E-06 NA mr1809 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 5.27E-07 9.03E-06 mr1820 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 1.94E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 1.08E-07 1.07E-07 mr1856 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213935504 NA 4.42E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251