\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213930150:

Variant ID: vg1213930150 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13930150
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGAACAAGATTTATATGGGTAGCCTACTGGAACAAAAGAACAAGATTTATGTGAAAAAGATTGAATGAACAACATATAGTTGTTCGCTTTGAAAAAA[A/T]
TTAATTGAGCAATAGACTAATAGGGCTCTGTATGAACATCATAATATATCTTCTATATTTGTGAAATACAAAACATATATTTGGGCCTGGTAACTTATGG

Reverse complement sequence

CCATAAGTTACCAGGCCCAAATATATGTTTTGTATTTCACAAATATAGAAGATATATTATGATGTTCATACAGAGCCCTATTAGTCTATTGCTCAATTAA[T/A]
TTTTTTCAAAGCGAACAACTATATGTTGTTCATTCAATCTTTTTCACATAAATCTTGTTCTTTTGTTCCAGTAGGCTACCCATATAAATCTTGTTCTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 45.50% 0.76% 0.00% NA
All Indica  2759 81.00% 18.10% 0.94% 0.00% NA
All Japonica  1512 16.00% 83.30% 0.66% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 77.60% 21.70% 0.67% 0.00% NA
Indica II  465 73.80% 24.90% 1.29% 0.00% NA
Indica III  913 87.00% 12.30% 0.77% 0.00% NA
Indica Intermediate  786 80.90% 17.90% 1.15% 0.00% NA
Temperate Japonica  767 10.40% 89.40% 0.13% 0.00% NA
Tropical Japonica  504 14.90% 83.90% 1.19% 0.00% NA
Japonica Intermediate  241 36.10% 62.70% 1.24% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213930150 A -> T LOC_Os12g24410.1 intron_variant ; MODIFIER silent_mutation Average:29.658; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213930150 NA 2.20E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 4.17E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 3.72E-14 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 1.95E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 1.53E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 7.84E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 4.78E-06 mr1826 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 3.12E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150 NA 3.62E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251