Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213930150:

Variant ID: vg1213930150 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13930150
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGAACAAGATTTATATGGGTAGCCTACTGGAACAAAAGAACAAGATTTATGTGAAAAAGATTGAATGAACAACATATAGTTGTTCGCTTTGAAAAAA[A/T]
TTAATTGAGCAATAGACTAATAGGGCTCTGTATGAACATCATAATATATCTTCTATATTTGTGAAATACAAAACATATATTTGGGCCTGGTAACTTATGG

Reverse complement sequence

CCATAAGTTACCAGGCCCAAATATATGTTTTGTATTTCACAAATATAGAAGATATATTATGATGTTCATACAGAGCCCTATTAGTCTATTGCTCAATTAA[T/A]
TTTTTTCAAAGCGAACAACTATATGTTGTTCATTCAATCTTTTTCACATAAATCTTGTTCTTTTGTTCCAGTAGGCTACCCATATAAATCTTGTTCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	45.50%	0.76%	0.00%	NA
All Indica	2759	81.00%	18.10%	0.94%	0.00%	NA
All Japonica	1512	16.00%	83.30%	0.66%	0.00%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	77.60%	21.70%	0.67%	0.00%	NA
Indica II	465	73.80%	24.90%	1.29%	0.00%	NA
Indica III	913	87.00%	12.30%	0.77%	0.00%	NA
Indica Intermediate	786	80.90%	17.90%	1.15%	0.00%	NA
Temperate Japonica	767	10.40%	89.40%	0.13%	0.00%	NA
Tropical Japonica	504	14.90%	83.90%	1.19%	0.00%	NA
Japonica Intermediate	241	36.10%	62.70%	1.24%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213930150	A -> T	LOC_Os12g24410.1	intron_variant ; MODIFIER	silent_mutation	Average:29.658; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213930150	NA	2.20E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	4.17E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	3.72E-14	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	1.95E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	1.53E-07	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	7.84E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	4.78E-06	mr1826	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	3.12E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213930150	NA	3.62E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251