\
| Variant ID: vg1213930150 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13930150 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.05, others allele: 0.00, population size: 182. )
AAAAGAACAAGATTTATATGGGTAGCCTACTGGAACAAAAGAACAAGATTTATGTGAAAAAGATTGAATGAACAACATATAGTTGTTCGCTTTGAAAAAA[A/T]
TTAATTGAGCAATAGACTAATAGGGCTCTGTATGAACATCATAATATATCTTCTATATTTGTGAAATACAAAACATATATTTGGGCCTGGTAACTTATGG
CCATAAGTTACCAGGCCCAAATATATGTTTTGTATTTCACAAATATAGAAGATATATTATGATGTTCATACAGAGCCCTATTAGTCTATTGCTCAATTAA[T/A]
TTTTTTCAAAGCGAACAACTATATGTTGTTCATTCAATCTTTTTCACATAAATCTTGTTCTTTTGTTCCAGTAGGCTACCCATATAAATCTTGTTCTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 45.50% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 81.00% | 18.10% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 16.00% | 83.30% | 0.66% | 0.00% | NA |
| Aus | 269 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.60% | 21.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 73.80% | 24.90% | 1.29% | 0.00% | NA |
| Indica III | 913 | 87.00% | 12.30% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 80.90% | 17.90% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 10.40% | 89.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 14.90% | 83.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.10% | 62.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213930150 | A -> T | LOC_Os12g24410.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213930150 | NA | 2.20E-14 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 4.17E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 3.72E-14 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 1.95E-14 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 1.53E-07 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 7.84E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 4.78E-06 | mr1826 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 3.12E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213930150 | NA | 3.62E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |