\
| Variant ID: vg1213797573 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13797573 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )
CTCGCGTAGCCTTTGCCTGCGCCTCCCTACGGGACGACGACGAGTCAGACAATGCTTGAATGGAATCACGGAAGTCTAAAAATTCATCTACTTACTTCTC[G/A]
CCAATCGTCACAATACGTTGTCGTCGTGGAGGCGGGGGAGACGCGTCCGAGGCCTGACAGACAATCAATGCGAAGTAAGGCAAAATCCTTCTGGCTGCAC
GTGCAGCCAGAAGGATTTTGCCTTACTTCGCATTGATTGTCTGTCAGGCCTCGGACGCGTCTCCCCCGCCTCCACGACGACAACGTATTGTGACGATTGG[C/T]
GAGAAGTAAGTAGATGAATTTTTAGACTTCCGTGATTCCATTCAAGCATTGTCTGACTCGTCGTCGTCCCGTAGGGAGGCGCAGGCAAAGGCTACGCGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 16.00% | 1.67% | 8.44% | NA |
| All Indica | 2759 | 71.00% | 21.70% | 1.78% | 5.51% | NA |
| All Japonica | 1512 | 91.00% | 0.20% | 0.33% | 8.47% | NA |
| Aus | 269 | 26.00% | 24.90% | 6.32% | 42.75% | NA |
| Indica I | 595 | 87.60% | 2.70% | 2.02% | 7.73% | NA |
| Indica II | 465 | 84.10% | 6.90% | 2.37% | 6.67% | NA |
| Indica III | 913 | 49.80% | 46.40% | 1.42% | 2.30% | NA |
| Indica Intermediate | 786 | 75.30% | 16.20% | 1.65% | 6.87% | NA |
| Temperate Japonica | 767 | 88.00% | 0.00% | 0.65% | 11.34% | NA |
| Tropical Japonica | 504 | 97.00% | 0.20% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.80% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 12.50% | 77.10% | 8.33% | 2.08% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213797573 | G -> DEL | LOC_Os12g24210.1 | N | frameshift_variant | Average:19.129; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg1213797573 | G -> A | LOC_Os12g24210.1 | synonymous_variant ; p.Gly321Gly; LOW | synonymous_codon | Average:19.129; most accessible tissue: Callus, score: 47.902 | N | N | N | N |
| vg1213797573 | G -> A | LOC_Os12g24210.1 | synonymous_variant ; p.Gly321Gly; LOW | nonsynonymous_codon ; G321S | Average:19.129; most accessible tissue: Callus, score: 47.902 | possibly damaging |
1.716 |
TOLERATED | 0.14 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213797573 | 7.32E-08 | NA | mr1129 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | NA | 8.87E-07 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 4.66E-06 | NA | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 7.69E-08 | 5.28E-17 | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 4.84E-07 | NA | mr1255 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 4.56E-07 | NA | mr1257 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | NA | 7.65E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 6.57E-06 | NA | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 8.95E-06 | NA | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 3.23E-06 | NA | mr1129_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | NA | 3.39E-07 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 1.86E-07 | NA | mr1255_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | 7.00E-06 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213797573 | NA | 7.07E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |