\
| Variant ID: vg1213729703 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13729703 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 61. )
TCAACTAATTACTCTGAAATTACCTCAAACAAATTCAGTAGCAGCAACGTCGTCGAGGCAGAGAGGTGGACGAAGGGGCAGAGATTGGTGACAGTGCTGC[C/T]
GCCGATGGCCCCAGCGGTGACCTGGACGGACGACCGACGGTGCCCTGGATCAACGGACGGTGGCACCCTGGACAGAGGACTGGCAGCTACCTGAATGGTG
CACCATTCAGGTAGCTGCCAGTCCTCTGTCCAGGGTGCCACCGTCCGTTGATCCAGGGCACCGTCGGTCGTCCGTCCAGGTCACCGCTGGGGCCATCGGC[G/A]
GCAGCACTGTCACCAATCTCTGCCCCTTCGTCCACCTCTCTGCCTCGACGACGTTGCTGCTACTGAATTTGTTTGAGGTAATTTCAGAGTAATTAGTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 36.40% | 0.34% | 12.55% | NA |
| All Indica | 2759 | 53.20% | 26.30% | 0.43% | 20.08% | NA |
| All Japonica | 1512 | 56.30% | 41.20% | 0.07% | 2.38% | NA |
| Aus | 269 | 3.70% | 95.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 50.10% | 47.90% | 0.34% | 1.68% | NA |
| Indica II | 465 | 31.80% | 24.50% | 0.43% | 43.23% | NA |
| Indica III | 913 | 65.40% | 15.70% | 0.55% | 18.40% | NA |
| Indica Intermediate | 786 | 54.10% | 23.30% | 0.38% | 22.26% | NA |
| Temperate Japonica | 767 | 83.30% | 12.30% | 0.00% | 4.43% | NA |
| Tropical Japonica | 504 | 15.90% | 83.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 37.80% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213729703 | C -> DEL | N | N | silent_mutation | Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| vg1213729703 | C -> T | LOC_Os12g24120.1 | downstream_gene_variant ; 3278.0bp to feature; MODIFIER | silent_mutation | Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| vg1213729703 | C -> T | LOC_Os12g24120-LOC_Os12g24130 | intergenic_region ; MODIFIER | silent_mutation | Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213729703 | NA | 4.50E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 4.12E-06 | mr1460 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 3.26E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 2.42E-06 | mr1639 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 7.82E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 1.24E-11 | mr1706 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 2.03E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 2.50E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 6.70E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 3.40E-06 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213729703 | NA | 2.52E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |