\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213729703:

Variant ID: vg1213729703 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13729703
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACTAATTACTCTGAAATTACCTCAAACAAATTCAGTAGCAGCAACGTCGTCGAGGCAGAGAGGTGGACGAAGGGGCAGAGATTGGTGACAGTGCTGC[C/T]
GCCGATGGCCCCAGCGGTGACCTGGACGGACGACCGACGGTGCCCTGGATCAACGGACGGTGGCACCCTGGACAGAGGACTGGCAGCTACCTGAATGGTG

Reverse complement sequence

CACCATTCAGGTAGCTGCCAGTCCTCTGTCCAGGGTGCCACCGTCCGTTGATCCAGGGCACCGTCGGTCGTCCGTCCAGGTCACCGCTGGGGCCATCGGC[G/A]
GCAGCACTGTCACCAATCTCTGCCCCTTCGTCCACCTCTCTGCCTCGACGACGTTGCTGCTACTGAATTTGTTTGAGGTAATTTCAGAGTAATTAGTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 36.40% 0.34% 12.55% NA
All Indica  2759 53.20% 26.30% 0.43% 20.08% NA
All Japonica  1512 56.30% 41.20% 0.07% 2.38% NA
Aus  269 3.70% 95.90% 0.37% 0.00% NA
Indica I  595 50.10% 47.90% 0.34% 1.68% NA
Indica II  465 31.80% 24.50% 0.43% 43.23% NA
Indica III  913 65.40% 15.70% 0.55% 18.40% NA
Indica Intermediate  786 54.10% 23.30% 0.38% 22.26% NA
Temperate Japonica  767 83.30% 12.30% 0.00% 4.43% NA
Tropical Japonica  504 15.90% 83.90% 0.20% 0.00% NA
Japonica Intermediate  241 55.20% 44.00% 0.00% 0.83% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 56.70% 37.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213729703 C -> DEL N N silent_mutation Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg1213729703 C -> T LOC_Os12g24120.1 downstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg1213729703 C -> T LOC_Os12g24120-LOC_Os12g24130 intergenic_region ; MODIFIER silent_mutation Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213729703 NA 4.50E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 4.12E-06 mr1460 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 3.26E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 2.42E-06 mr1639 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 7.82E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 1.24E-11 mr1706 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 2.03E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 2.50E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 6.70E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 3.40E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703 NA 2.52E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251