Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213728830:

Variant ID: vg1213728830 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13728830
Reference Allele: A	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTAAGTTGTTATCAAAAGGTCACTGCAACAATTTGCCAGCTAGCTTATGGTATAGTAGGAGATGCTTTGGATGAATATATTGGTCTTGGAGAAAGTACC[A/T,G]
CTATATATAGAGAGTCTGAGAAGGTTTGTAAAAACAGTTATTGAAGTTTCTGAACATGAGTTCACCCAATGAGAACGATACAACTCGATTACTTACTCTT

Reverse complement sequence

AAGAGTAAGTAATCGAGTTGTATCGTTCTCATTGGGTGAACTCATGTTCAGAAACTTCAATAACTGTTTTTACAAACCTTCTCAGACTCTCTATATATAG[T/A,C]
GGTACTTTCTCCAAGACCAATATATTCATCCAAAGCATCTCCTACTATACCATAAGCTAGCTGGCAAATTGTTGCAGTGACCTTTTGATAACAACTTAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	15.10%	0.28%	12.95%	G: 12.74%
All Indica	2759	62.80%	1.80%	0.22%	20.66%	G: 14.43%
All Japonica	1512	42.50%	42.70%	0.40%	2.58%	G: 11.77%
Aus	269	97.40%	0.00%	0.00%	0.00%	G: 2.60%
Indica I	595	86.70%	0.20%	0.50%	1.85%	G: 10.76%
Indica II	465	48.40%	3.70%	0.22%	43.87%	G: 3.87%
Indica III	913	62.00%	1.20%	0.11%	19.17%	G: 17.52%
Indica Intermediate	786	54.30%	2.80%	0.13%	22.90%	G: 19.85%
Temperate Japonica	767	13.80%	76.90%	0.26%	4.82%	G: 4.17%
Tropical Japonica	504	84.90%	0.60%	0.40%	0.00%	G: 14.09%
Japonica Intermediate	241	45.20%	22.00%	0.83%	0.83%	G: 31.12%
VI/Aromatic	96	95.80%	0.00%	0.00%	0.00%	G: 4.17%
Intermediate	90	58.90%	20.00%	1.11%	3.33%	G: 16.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213728830	A -> DEL	N	N	silent_mutation	Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1213728830	A -> G	LOC_Os12g24120.1	downstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1213728830	A -> G	LOC_Os12g24120-LOC_Os12g24130	intergenic_region ; MODIFIER	silent_mutation	Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1213728830	A -> T	LOC_Os12g24120.1	downstream_gene_variant ; 2405.0bp to feature; MODIFIER	silent_mutation	Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg1213728830	A -> T	LOC_Os12g24120-LOC_Os12g24130	intergenic_region ; MODIFIER	silent_mutation	Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213728830	NA	1.84E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	4.85E-09	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.77E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	5.13E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	7.52E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	4.29E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.29E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	2.29E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	6.04E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	1.09E-06	1.09E-06	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	2.38E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.78E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	7.96E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	8.98E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	5.22E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.23E-17	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.76E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	1.00E-13	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830	NA	4.23E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251