\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213728830:

Variant ID: vg1213728830 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13728830
Reference Allele: AAlternative Allele: T,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTAAGTTGTTATCAAAAGGTCACTGCAACAATTTGCCAGCTAGCTTATGGTATAGTAGGAGATGCTTTGGATGAATATATTGGTCTTGGAGAAAGTACC[A/T,G]
CTATATATAGAGAGTCTGAGAAGGTTTGTAAAAACAGTTATTGAAGTTTCTGAACATGAGTTCACCCAATGAGAACGATACAACTCGATTACTTACTCTT

Reverse complement sequence

AAGAGTAAGTAATCGAGTTGTATCGTTCTCATTGGGTGAACTCATGTTCAGAAACTTCAATAACTGTTTTTACAAACCTTCTCAGACTCTCTATATATAG[T/A,C]
GGTACTTTCTCCAAGACCAATATATTCATCCAAAGCATCTCCTACTATACCATAAGCTAGCTGGCAAATTGTTGCAGTGACCTTTTGATAACAACTTAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 15.10% 0.28% 12.95% G: 12.74%
All Indica  2759 62.80% 1.80% 0.22% 20.66% G: 14.43%
All Japonica  1512 42.50% 42.70% 0.40% 2.58% G: 11.77%
Aus  269 97.40% 0.00% 0.00% 0.00% G: 2.60%
Indica I  595 86.70% 0.20% 0.50% 1.85% G: 10.76%
Indica II  465 48.40% 3.70% 0.22% 43.87% G: 3.87%
Indica III  913 62.00% 1.20% 0.11% 19.17% G: 17.52%
Indica Intermediate  786 54.30% 2.80% 0.13% 22.90% G: 19.85%
Temperate Japonica  767 13.80% 76.90% 0.26% 4.82% G: 4.17%
Tropical Japonica  504 84.90% 0.60% 0.40% 0.00% G: 14.09%
Japonica Intermediate  241 45.20% 22.00% 0.83% 0.83% G: 31.12%
VI/Aromatic  96 95.80% 0.00% 0.00% 0.00% G: 4.17%
Intermediate  90 58.90% 20.00% 1.11% 3.33% G: 16.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213728830 A -> DEL N N silent_mutation Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1213728830 A -> G LOC_Os12g24120.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1213728830 A -> G LOC_Os12g24120-LOC_Os12g24130 intergenic_region ; MODIFIER silent_mutation Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1213728830 A -> T LOC_Os12g24120.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1213728830 A -> T LOC_Os12g24120-LOC_Os12g24130 intergenic_region ; MODIFIER silent_mutation Average:54.234; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213728830 NA 1.84E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 4.85E-09 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.77E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 5.13E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 7.52E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 4.29E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.29E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 2.29E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 6.04E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 1.09E-06 1.09E-06 mr1335_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 2.38E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.78E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 7.96E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 8.98E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 5.22E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.23E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.76E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 1.00E-13 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213728830 NA 4.23E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251