Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213709694:

Variant ID: vg1213709694 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13709694
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAGAGGGAAGGAAAGCGCACCAAGGTGGAGGAAAGGACTTCGGAGGTGATTACTATCAAAATAGGGTCCCATGATGTGCCTATACCTTCTCGAGAT[G/A]
GAGTTGGAAAGTCTCCAAGCAAAAAATCCGAAGCCAGTACCAACCCCTCGCAGTCAGCCGGTCTGACCAGGCCTTCTAGCCGGTCTGACCGTGGCCATGT

Reverse complement sequence

ACATGGCCACGGTCAGACCGGCTAGAAGGCCTGGTCAGACCGGCTGACTGCGAGGGGTTGGTACTGGCTTCGGATTTTTTGCTTGGAGACTTTCCAACTC[C/T]
ATCTCGAGAAGGTATAGGCACATCATGGGACCCTATTTTGATAGTAATCACCTCCGAAGTCCTTTCCTCCACCTTGGTGCGCTTTCCTTCCCTCTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	1.60%	27.44%	22.43%	NA
All Indica	2759	44.20%	2.70%	37.77%	15.30%	NA
All Japonica	1512	55.20%	0.00%	8.07%	36.77%	NA
Aus	269	52.00%	0.00%	26.39%	21.56%	NA
Indica I	595	10.80%	4.70%	45.88%	38.66%	NA
Indica II	465	75.50%	0.60%	17.63%	6.24%	NA
Indica III	913	44.90%	3.50%	46.99%	4.60%	NA
Indica Intermediate	786	50.30%	1.50%	32.82%	15.39%	NA
Temperate Japonica	767	85.90%	0.00%	4.04%	10.04%	NA
Tropical Japonica	504	17.90%	0.00%	11.11%	71.03%	NA
Japonica Intermediate	241	35.30%	0.00%	14.52%	50.21%	NA
VI/Aromatic	96	47.90%	0.00%	44.79%	7.29%	NA
Intermediate	90	57.80%	2.20%	21.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213709694	G -> DEL	N	N	silent_mutation	Average:22.716; most accessible tissue: Callus, score: 41.875	N	N	N	N
vg1213709694	G -> A	LOC_Os12g24090.1	upstream_gene_variant ; 3537.0bp to feature; MODIFIER	silent_mutation	Average:22.716; most accessible tissue: Callus, score: 41.875	N	N	N	N
vg1213709694	G -> A	LOC_Os12g24110.1	upstream_gene_variant ; 3410.0bp to feature; MODIFIER	silent_mutation	Average:22.716; most accessible tissue: Callus, score: 41.875	N	N	N	N
vg1213709694	G -> A	LOC_Os12g24100.1	intron_variant ; MODIFIER	silent_mutation	Average:22.716; most accessible tissue: Callus, score: 41.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213709694	NA	4.22E-09	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	7.85E-06	1.87E-07	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	NA	8.52E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	5.72E-06	3.41E-06	mr1482_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	NA	3.37E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	NA	3.99E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	NA	7.73E-07	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	8.61E-08	NA	mr1789_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	9.66E-06	NA	mr1874_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213709694	NA	2.56E-06	mr1887_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251