\
| Variant ID: vg1213707083 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13707083 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.16, others allele: 0.00, population size: 107. )
AGGTGGTTGGCGACTCTAGGATCACTGCAAGACTTAAGGTGCTACAATCGTGCTTGTCAACTTGTCACAAAAAGTTACCAACACGATTTTTGGCGACTCC[G/A]
CTGGGGACAGATCCGTTCATCGTCAACTCGACTTCGACTTCGCCATGACGAAGCCATCGTCCAAGACGGAGGTAGAGCCATCTCATGTGATACCGGTCAC
GTGACCGGTATCACATGAGATGGCTCTACCTCCGTCTTGGACGATGGCTTCGTCATGGCGAAGTCGAAGTCGAGTTGACGATGAACGGATCTGTCCCCAG[C/T]
GGAGTCGCCAAAAATCGTGTTGGTAACTTTTTGTGACAAGTTGACAAGCACGATTGTAGCACCTTAAGTCTTGCAGTGATCCTAGAGTCGCCAACCACCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 15.70% | 14.50% | 35.27% | 34.53% | NA |
| All Indica | 2759 | 2.20% | 23.00% | 45.31% | 29.47% | NA |
| All Japonica | 1512 | 43.30% | 3.00% | 7.94% | 45.77% | NA |
| Aus | 269 | 0.40% | 0.40% | 78.44% | 20.82% | NA |
| Indica I | 595 | 1.30% | 2.50% | 31.26% | 64.87% | NA |
| Indica II | 465 | 3.70% | 48.00% | 35.70% | 12.69% | NA |
| Indica III | 913 | 1.60% | 21.10% | 59.58% | 17.63% | NA |
| Indica Intermediate | 786 | 2.80% | 25.80% | 45.04% | 26.34% | NA |
| Temperate Japonica | 767 | 77.40% | 5.20% | 2.74% | 14.60% | NA |
| Tropical Japonica | 504 | 0.80% | 0.20% | 13.10% | 85.91% | NA |
| Japonica Intermediate | 241 | 23.70% | 1.70% | 13.69% | 61.00% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 56.25% | 42.71% | NA |
| Intermediate | 90 | 25.60% | 5.60% | 35.56% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213707083 | G -> DEL | N | N | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1213707083 | G -> A | LOC_Os12g24090.1 | upstream_gene_variant ; 926.0bp to feature; MODIFIER | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1213707083 | G -> A | LOC_Os12g24100.1 | upstream_gene_variant ; 45.0bp to feature; MODIFIER | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1213707083 | G -> A | LOC_Os12g24080.1 | downstream_gene_variant ; 4504.0bp to feature; MODIFIER | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1213707083 | G -> A | LOC_Os12g24084.1 | downstream_gene_variant ; 3242.0bp to feature; MODIFIER | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1213707083 | G -> A | LOC_Os12g24090-LOC_Os12g24100 | intergenic_region ; MODIFIER | silent_mutation | Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213707083 | NA | 7.50E-15 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 6.67E-13 | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 2.01E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 7.25E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 8.62E-07 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 5.93E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 3.73E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 1.48E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | 4.90E-06 | NA | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 1.72E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 5.79E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | 4.39E-08 | NA | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 4.19E-12 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213707083 | NA | 1.61E-10 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |