\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213707083:

Variant ID: vg1213707083 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13707083
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTGGTTGGCGACTCTAGGATCACTGCAAGACTTAAGGTGCTACAATCGTGCTTGTCAACTTGTCACAAAAAGTTACCAACACGATTTTTGGCGACTCC[G/A]
CTGGGGACAGATCCGTTCATCGTCAACTCGACTTCGACTTCGCCATGACGAAGCCATCGTCCAAGACGGAGGTAGAGCCATCTCATGTGATACCGGTCAC

Reverse complement sequence

GTGACCGGTATCACATGAGATGGCTCTACCTCCGTCTTGGACGATGGCTTCGTCATGGCGAAGTCGAAGTCGAGTTGACGATGAACGGATCTGTCCCCAG[C/T]
GGAGTCGCCAAAAATCGTGTTGGTAACTTTTTGTGACAAGTTGACAAGCACGATTGTAGCACCTTAAGTCTTGCAGTGATCCTAGAGTCGCCAACCACCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.70% 14.50% 35.27% 34.53% NA
All Indica  2759 2.20% 23.00% 45.31% 29.47% NA
All Japonica  1512 43.30% 3.00% 7.94% 45.77% NA
Aus  269 0.40% 0.40% 78.44% 20.82% NA
Indica I  595 1.30% 2.50% 31.26% 64.87% NA
Indica II  465 3.70% 48.00% 35.70% 12.69% NA
Indica III  913 1.60% 21.10% 59.58% 17.63% NA
Indica Intermediate  786 2.80% 25.80% 45.04% 26.34% NA
Temperate Japonica  767 77.40% 5.20% 2.74% 14.60% NA
Tropical Japonica  504 0.80% 0.20% 13.10% 85.91% NA
Japonica Intermediate  241 23.70% 1.70% 13.69% 61.00% NA
VI/Aromatic  96 1.00% 0.00% 56.25% 42.71% NA
Intermediate  90 25.60% 5.60% 35.56% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213707083 G -> DEL N N silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1213707083 G -> A LOC_Os12g24090.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1213707083 G -> A LOC_Os12g24100.1 upstream_gene_variant ; 45.0bp to feature; MODIFIER silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1213707083 G -> A LOC_Os12g24080.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1213707083 G -> A LOC_Os12g24084.1 downstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1213707083 G -> A LOC_Os12g24090-LOC_Os12g24100 intergenic_region ; MODIFIER silent_mutation Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213707083 NA 7.50E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 6.67E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 2.01E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 7.25E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 8.62E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 5.93E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 3.73E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 1.48E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 4.90E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 1.72E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 5.79E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 4.39E-08 NA mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 4.19E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083 NA 1.61E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251