Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213707083:

Variant ID: vg1213707083 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13707083
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTGGTTGGCGACTCTAGGATCACTGCAAGACTTAAGGTGCTACAATCGTGCTTGTCAACTTGTCACAAAAAGTTACCAACACGATTTTTGGCGACTCC[G/A]
CTGGGGACAGATCCGTTCATCGTCAACTCGACTTCGACTTCGCCATGACGAAGCCATCGTCCAAGACGGAGGTAGAGCCATCTCATGTGATACCGGTCAC

Reverse complement sequence

GTGACCGGTATCACATGAGATGGCTCTACCTCCGTCTTGGACGATGGCTTCGTCATGGCGAAGTCGAAGTCGAGTTGACGATGAACGGATCTGTCCCCAG[C/T]
GGAGTCGCCAAAAATCGTGTTGGTAACTTTTTGTGACAAGTTGACAAGCACGATTGTAGCACCTTAAGTCTTGCAGTGATCCTAGAGTCGCCAACCACCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	15.70%	14.50%	35.27%	34.53%	NA
All Indica	2759	2.20%	23.00%	45.31%	29.47%	NA
All Japonica	1512	43.30%	3.00%	7.94%	45.77%	NA
Aus	269	0.40%	0.40%	78.44%	20.82%	NA
Indica I	595	1.30%	2.50%	31.26%	64.87%	NA
Indica II	465	3.70%	48.00%	35.70%	12.69%	NA
Indica III	913	1.60%	21.10%	59.58%	17.63%	NA
Indica Intermediate	786	2.80%	25.80%	45.04%	26.34%	NA
Temperate Japonica	767	77.40%	5.20%	2.74%	14.60%	NA
Tropical Japonica	504	0.80%	0.20%	13.10%	85.91%	NA
Japonica Intermediate	241	23.70%	1.70%	13.69%	61.00%	NA
VI/Aromatic	96	1.00%	0.00%	56.25%	42.71%	NA
Intermediate	90	25.60%	5.60%	35.56%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213707083	G -> DEL	N	N	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1213707083	G -> A	LOC_Os12g24090.1	upstream_gene_variant ; 926.0bp to feature; MODIFIER	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1213707083	G -> A	LOC_Os12g24100.1	upstream_gene_variant ; 45.0bp to feature; MODIFIER	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1213707083	G -> A	LOC_Os12g24080.1	downstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1213707083	G -> A	LOC_Os12g24084.1	downstream_gene_variant ; 3242.0bp to feature; MODIFIER	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1213707083	G -> A	LOC_Os12g24090-LOC_Os12g24100	intergenic_region ; MODIFIER	silent_mutation	Average:21.096; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213707083	NA	7.50E-15	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	6.67E-13	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	2.01E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	7.25E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	8.62E-07	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	5.93E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	3.73E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	1.48E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	4.90E-06	NA	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	1.72E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	5.79E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	4.39E-08	NA	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	4.19E-12	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213707083	NA	1.61E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251