\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213653651:

Variant ID: vg1213653651 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13653651
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCTCCATTATCACAAAACTACAGGTTAAAACCTGTGATAATGAAAACACTAAACCTGTAGCTTTGTGATAAATGAAAATATTAAATCTGCAGTTTTGT[G/A]
AAACAAGTTCTTAAATCTGTAGTTTTGTGATATATTGTGCATAATACTTGTAGTTCTGTGATAAACGAAGATATTAAATCTGTAGTTTTGTGAAATAAGT

Reverse complement sequence

ACTTATTTCACAAAACTACAGATTTAATATCTTCGTTTATCACAGAACTACAAGTATTATGCACAATATATCACAAAACTACAGATTTAAGAACTTGTTT[C/T]
ACAAAACTGCAGATTTAATATTTTCATTTATCACAAAGCTACAGGTTTAGTGTTTTCATTATCACAGGTTTTAACCTGTAGTTTTGTGATAATGGAGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 14.00% 1.04% 0.00% NA
All Indica  2759 79.20% 20.20% 0.69% 0.00% NA
All Japonica  1512 91.70% 6.40% 1.92% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 1.70% 1.34% 0.00% NA
Indica II  465 53.10% 46.20% 0.65% 0.00% NA
Indica III  913 82.00% 17.50% 0.44% 0.00% NA
Indica Intermediate  786 77.70% 21.80% 0.51% 0.00% NA
Temperate Japonica  767 92.20% 6.80% 1.04% 0.00% NA
Tropical Japonica  504 91.70% 6.30% 1.98% 0.00% NA
Japonica Intermediate  241 90.00% 5.40% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213653651 G -> A LOC_Os12g24020.1 upstream_gene_variant ; 3448.0bp to feature; MODIFIER silent_mutation Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1213653651 G -> A LOC_Os12g24020.2 upstream_gene_variant ; 3448.0bp to feature; MODIFIER silent_mutation Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1213653651 G -> A LOC_Os12g24020.3 upstream_gene_variant ; 3449.0bp to feature; MODIFIER silent_mutation Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1213653651 G -> A LOC_Os12g24010-LOC_Os12g24020 intergenic_region ; MODIFIER silent_mutation Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213653651 NA 2.31E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 2.74E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 6.08E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 1.84E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 6.45E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 6.29E-06 NA mr1319 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 7.67E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 6.01E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 1.77E-06 1.77E-06 mr1674 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 7.18E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 1.76E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651 NA 1.93E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251