\
| Variant ID: vg1213653651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13653651 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )
TGTCTCCATTATCACAAAACTACAGGTTAAAACCTGTGATAATGAAAACACTAAACCTGTAGCTTTGTGATAAATGAAAATATTAAATCTGCAGTTTTGT[G/A]
AAACAAGTTCTTAAATCTGTAGTTTTGTGATATATTGTGCATAATACTTGTAGTTCTGTGATAAACGAAGATATTAAATCTGTAGTTTTGTGAAATAAGT
ACTTATTTCACAAAACTACAGATTTAATATCTTCGTTTATCACAGAACTACAAGTATTATGCACAATATATCACAAAACTACAGATTTAAGAACTTGTTT[C/T]
ACAAAACTGCAGATTTAATATTTTCATTTATCACAAAGCTACAGGTTTAGTGTTTTCATTATCACAGGTTTTAACCTGTAGTTTTGTGATAATGGAGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 14.00% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 79.20% | 20.20% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 6.40% | 1.92% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 1.70% | 1.34% | 0.00% | NA |
| Indica II | 465 | 53.10% | 46.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 82.00% | 17.50% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 77.70% | 21.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 92.20% | 6.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 6.30% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 5.40% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213653651 | G -> A | LOC_Os12g24020.1 | upstream_gene_variant ; 3448.0bp to feature; MODIFIER | silent_mutation | Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1213653651 | G -> A | LOC_Os12g24020.2 | upstream_gene_variant ; 3448.0bp to feature; MODIFIER | silent_mutation | Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1213653651 | G -> A | LOC_Os12g24020.3 | upstream_gene_variant ; 3449.0bp to feature; MODIFIER | silent_mutation | Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1213653651 | G -> A | LOC_Os12g24010-LOC_Os12g24020 | intergenic_region ; MODIFIER | silent_mutation | Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213653651 | NA | 2.31E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 2.74E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 6.08E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 1.84E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 6.45E-07 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | 6.29E-06 | NA | mr1319 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 7.67E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 6.01E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | 1.77E-06 | 1.77E-06 | mr1674 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 7.18E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 1.76E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213653651 | NA | 1.93E-06 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |