Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213620561:

Variant ID: vg1213620561 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13620561
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTATCCTTTGATATTACCCTGCATCATACCCCTATCCCGGTATGACTTGCTGAGTACAGTGGGTAGTACTTAGTCTTGCTCTATTTTCCCCAAACCCC[C/T]
AGAGTTTGAGTATGCGTCAGATGGTGGCTTCTCCAAGGAGTAGGCTTCGTCCGTGCCGTCGAGGATGCCTGTGGAGTGGTGATTCCGCTGCGGTCCAAAT

Reverse complement sequence

ATTTGGACCGCAGCGGAATCACCACTCCACAGGCATCCTCGACGGCACGGACGAAGCCTACTCCTTGGAGAAGCCACCATCTGACGCATACTCAAACTCT[G/A]
GGGGTTTGGGGAAAATAGAGCAAGACTAAGTACTACCCACTGTACTCAGCAAGTCATACCGGGATAGGGGTATGATGCAGGGTAATATCAAAGGATAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.30%	0.08%	0.00%	NA
All Indica	2759	77.60%	22.40%	0.04%	0.00%	NA
All Japonica	1512	58.80%	41.00%	0.20%	0.00%	NA
Aus	269	80.30%	19.70%	0.00%	0.00%	NA
Indica I	595	54.10%	45.90%	0.00%	0.00%	NA
Indica II	465	78.50%	21.30%	0.22%	0.00%	NA
Indica III	913	88.10%	11.90%	0.00%	0.00%	NA
Indica Intermediate	786	82.60%	17.40%	0.00%	0.00%	NA
Temperate Japonica	767	87.40%	12.60%	0.00%	0.00%	NA
Tropical Japonica	504	16.10%	83.50%	0.40%	0.00%	NA
Japonica Intermediate	241	57.30%	42.30%	0.41%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213620561	C -> T	LOC_Os12g23970.1	upstream_gene_variant ; 1404.0bp to feature; MODIFIER	silent_mutation	Average:54.37; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg1213620561	C -> T	LOC_Os12g23960.1	downstream_gene_variant ; 4534.0bp to feature; MODIFIER	silent_mutation	Average:54.37; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg1213620561	C -> T	LOC_Os12g23980.1	downstream_gene_variant ; 4683.0bp to feature; MODIFIER	silent_mutation	Average:54.37; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg1213620561	C -> T	LOC_Os12g23960-LOC_Os12g23970	intergenic_region ; MODIFIER	silent_mutation	Average:54.37; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213620561	NA	1.16E-06	mr1186	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	8.45E-08	mr1639	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	3.83E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	1.58E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	9.98E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	6.00E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	3.80E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	3.40E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	1.87E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	3.30E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	8.45E-06	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	2.37E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	6.06E-06	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	4.62E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	2.74E-06	mr1469_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	5.79E-06	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	4.34E-06	mr1474_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	5.84E-06	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	5.76E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	5.48E-07	mr1578_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	2.12E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	8.98E-06	mr1820_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213620561	NA	4.18E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251