\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213616605:

Variant ID: vg1213616605 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13616605
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGAGAAGTCCATGGGGGTCGCTGGGGAGTCCATTGCCTCTGGTTTTGAGGGGGAGATTATGATCCAGGAACGGTGCACTGTGGTGAGTTGTGTTGTGC[G/A]
AGGGGTATTGTCACAGTTCTTTCCGAGGTACCGTGGTGGTACTAAGGCGCATGGTAACATGTTGTGGGATTGTGTCCTGTGGGTACAGTGGTACACCTCT

Reverse complement sequence

AGAGGTGTACCACTGTACCCACAGGACACAATCCCACAACATGTTACCATGCGCCTTAGTACCACCACGGTACCTCGGAAAGAACTGTGACAATACCCCT[C/T]
GCACAACACAACTCACCACAGTGCACCGTTCCTGGATCATAATCTCCCCCTCAAAACCAGAGGCAATGGACTCCCCAGCGACCCCCATGGACTTCTCGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.20% 0.02% 0.00% NA
All Indica  2759 95.70% 4.30% 0.00% 0.00% NA
All Japonica  1512 60.00% 39.90% 0.07% 0.00% NA
Aus  269 80.70% 19.30% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 87.90% 12.10% 0.00% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 59.30% 40.20% 0.41% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213616605 G -> A LOC_Os12g23960.1 downstream_gene_variant ; 578.0bp to feature; MODIFIER silent_mutation Average:39.837; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1213616605 G -> A LOC_Os12g23960-LOC_Os12g23970 intergenic_region ; MODIFIER silent_mutation Average:39.837; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213616605 4.14E-06 NA mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 6.62E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 2.43E-06 2.43E-06 mr1299 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 1.52E-06 1.52E-06 mr1376 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 1.52E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 1.52E-06 1.52E-06 mr1431 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 4.86E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 9.03E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 1.21E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 6.69E-06 6.69E-06 mr1727 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 1.44E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213616605 NA 9.72E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251