\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213545780:

Variant ID: vg1213545780 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13545780
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACCACTAGCACAAATAACATTTTCGATGGCGGAGGATAAAGACAACCGCCAATGAAAACATTTTCTGGATTGAAAAAAAAAAGAAAATAGGGATCCCT[A/G]
TTTTGGAAAAAAAACAATTGAAAATTGACCTCCATCGCCGTGCCCATCCTCCATCGCCGGTGGGAGGATTGGCGAAGGACGACGATGAGGTGGGTCGCCG

Reverse complement sequence

CGGCGACCCACCTCATCGTCGTCCTTCGCCAATCCTCCCACCGGCGATGGAGGATGGGCACGGCGATGGAGGTCAATTTTCAATTGTTTTTTTTCCAAAA[T/C]
AGGGATCCCTATTTTCTTTTTTTTTTCAATCCAGAAAATGTTTTCATTGGCGGTTGTCTTTATCCTCCGCCATCGAAAATGTTATTTGTGCTAGTGGTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 12.60% 0.00% 0.00% NA
All Indica  2759 85.80% 14.20% 0.00% 0.00% NA
All Japonica  1512 88.40% 11.60% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 89.10% 10.90% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 82.60% 17.40% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 19.20% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213545780 A -> G LOC_Os12g23830.1 upstream_gene_variant ; 2480.0bp to feature; MODIFIER silent_mutation Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg1213545780 A -> G LOC_Os12g23820.1 downstream_gene_variant ; 4102.0bp to feature; MODIFIER silent_mutation Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg1213545780 A -> G LOC_Os12g23820-LOC_Os12g23830 intergenic_region ; MODIFIER silent_mutation Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213545780 NA 4.14E-09 mr1177 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213545780 NA 6.59E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213545780 NA 2.88E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213545780 NA 1.24E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251