\
| Variant ID: vg1213545780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13545780 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAACCACTAGCACAAATAACATTTTCGATGGCGGAGGATAAAGACAACCGCCAATGAAAACATTTTCTGGATTGAAAAAAAAAAGAAAATAGGGATCCCT[A/G]
TTTTGGAAAAAAAACAATTGAAAATTGACCTCCATCGCCGTGCCCATCCTCCATCGCCGGTGGGAGGATTGGCGAAGGACGACGATGAGGTGGGTCGCCG
CGGCGACCCACCTCATCGTCGTCCTTCGCCAATCCTCCCACCGGCGATGGAGGATGGGCACGGCGATGGAGGTCAATTTTCAATTGTTTTTTTTCCAAAA[T/C]
AGGGATCCCTATTTTCTTTTTTTTTTCAATCCAGAAAATGTTTTCATTGGCGGTTGTCTTTATCCTCCGCCATCGAAAATGTTATTTGTGCTAGTGGTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213545780 | A -> G | LOC_Os12g23830.1 | upstream_gene_variant ; 2480.0bp to feature; MODIFIER | silent_mutation | Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg1213545780 | A -> G | LOC_Os12g23820.1 | downstream_gene_variant ; 4102.0bp to feature; MODIFIER | silent_mutation | Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg1213545780 | A -> G | LOC_Os12g23820-LOC_Os12g23830 | intergenic_region ; MODIFIER | silent_mutation | Average:44.107; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213545780 | NA | 4.14E-09 | mr1177 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213545780 | NA | 6.59E-06 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213545780 | NA | 2.88E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213545780 | NA | 1.24E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |