\
| Variant ID: vg1213526586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13526586 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGTTACTTTCTTGCAGTAACAATATTATAACGTTGTCAAAATATAGTGATGACGGATTTAGTTTTGTAAAGCTCTTTTTTTAAAGCATTATGGTGGAAA[C/T]
GGTTCAAAAATATAATATGTGATGCGAGAGATACGATTGTTTAAAGATTAGAATTTCAAATAATCCACTTGCGTTTAGTTTGCTATTATGTATCTTTTGT
ACAAAAGATACATAATAGCAAACTAAACGCAAGTGGATTATTTGAAATTCTAATCTTTAAACAATCGTATCTCTCGCATCACATATTATATTTTTGAACC[G/A]
TTTCCACCATAATGCTTTAAAAAAAGAGCTTTACAAAACTAAATCCGTCATCACTATATTTTGACAACGTTATAATATTGTTACTGCAAGAAAGTAACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 2.00% | 2.37% | 15.85% | NA |
| All Indica | 2759 | 82.70% | 0.10% | 0.83% | 16.42% | NA |
| All Japonica | 1512 | 74.10% | 6.00% | 5.62% | 14.29% | NA |
| Aus | 269 | 87.40% | 0.00% | 0.74% | 11.90% | NA |
| Indica I | 595 | 76.60% | 0.00% | 1.01% | 22.35% | NA |
| Indica II | 465 | 83.40% | 0.20% | 1.72% | 14.62% | NA |
| Indica III | 913 | 86.10% | 0.00% | 0.55% | 13.36% | NA |
| Indica Intermediate | 786 | 82.80% | 0.10% | 0.51% | 16.54% | NA |
| Temperate Japonica | 767 | 86.80% | 0.00% | 1.69% | 11.47% | NA |
| Tropical Japonica | 504 | 53.60% | 17.50% | 12.50% | 16.47% | NA |
| Japonica Intermediate | 241 | 76.30% | 1.20% | 3.73% | 18.67% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 2.08% | 31.25% | NA |
| Intermediate | 90 | 78.90% | 1.10% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213526586 | C -> DEL | N | N | silent_mutation | Average:14.173; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1213526586 | C -> T | LOC_Os12g23800.1 | downstream_gene_variant ; 1246.0bp to feature; MODIFIER | silent_mutation | Average:14.173; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1213526586 | C -> T | LOC_Os12g23790-LOC_Os12g23800 | intergenic_region ; MODIFIER | silent_mutation | Average:14.173; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213526586 | NA | 3.21E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | 7.48E-07 | NA | mr1040_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 4.27E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 3.72E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 7.48E-08 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 2.26E-08 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 3.13E-07 | mr1253_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | NA | 3.99E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213526586 | 7.02E-06 | 9.75E-10 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |