Variant ID: vg1213478487 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 13478487 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTATATAATTGTAGATTATTTTGGAGATTCTTAGGAGTAATCGGTTCACGGTAGATATTCGGATTTAATTACTAAGAATTGTATTTTGCATTGAATTTTA[A/G]
AGGAGGTACTTTTGAATCACAAAATGACTTAGGGTGAATGAGCTTAAAATTGGAATAAAGTGGTTTTGCAAACTTTGTAGTCGATATAGAAAGATCGATT
AATCGATCTTTCTATATCGACTACAAAGTTTGCAAAACCACTTTATTCCAATTTTAAGCTCATTCACCCTAAGTCATTTTGTGATTCAAAAGTACCTCCT[T/C]
TAAAATTCAATGCAAAATACAATTCTTAGTAATTAAATCCGAATATCTACCGTGAACCGATTACTCCTAAGAATCTCCAAAATAATCTACAATTATATAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 83.10% | 15.10% | 1.82% | 0.00% | NA |
All Indica | 2759 | 95.50% | 1.40% | 3.04% | 0.00% | NA |
All Japonica | 1512 | 56.90% | 43.00% | 0.13% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 0.30% | 0.84% | 0.00% | NA |
Indica II | 465 | 87.30% | 3.00% | 9.68% | 0.00% | NA |
Indica III | 913 | 98.50% | 0.40% | 1.10% | 0.00% | NA |
Indica Intermediate | 786 | 94.50% | 2.40% | 3.05% | 0.00% | NA |
Temperate Japonica | 767 | 22.70% | 77.10% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1213478487 | A -> G | LOC_Os12g23750.1 | downstream_gene_variant ; 1884.0bp to feature; MODIFIER | silent_mutation | Average:16.669; most accessible tissue: Callus, score: 26.607 | N | N | N | N |
vg1213478487 | A -> G | LOC_Os12g23750-LOC_Os12g23754 | intergenic_region ; MODIFIER | silent_mutation | Average:16.669; most accessible tissue: Callus, score: 26.607 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1213478487 | 2.02E-06 | 3.94E-10 | mr1606 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213478487 | NA | 8.47E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213478487 | NA | 1.84E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213478487 | NA | 8.86E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213478487 | NA | 4.89E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |