\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213478487:

Variant ID: vg1213478487 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13478487
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATAATTGTAGATTATTTTGGAGATTCTTAGGAGTAATCGGTTCACGGTAGATATTCGGATTTAATTACTAAGAATTGTATTTTGCATTGAATTTTA[A/G]
AGGAGGTACTTTTGAATCACAAAATGACTTAGGGTGAATGAGCTTAAAATTGGAATAAAGTGGTTTTGCAAACTTTGTAGTCGATATAGAAAGATCGATT

Reverse complement sequence

AATCGATCTTTCTATATCGACTACAAAGTTTGCAAAACCACTTTATTCCAATTTTAAGCTCATTCACCCTAAGTCATTTTGTGATTCAAAAGTACCTCCT[T/C]
TAAAATTCAATGCAAAATACAATTCTTAGTAATTAAATCCGAATATCTACCGTGAACCGATTACTCCTAAGAATCTCCAAAATAATCTACAATTATATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 15.10% 1.82% 0.00% NA
All Indica  2759 95.50% 1.40% 3.04% 0.00% NA
All Japonica  1512 56.90% 43.00% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.30% 0.84% 0.00% NA
Indica II  465 87.30% 3.00% 9.68% 0.00% NA
Indica III  913 98.50% 0.40% 1.10% 0.00% NA
Indica Intermediate  786 94.50% 2.40% 3.05% 0.00% NA
Temperate Japonica  767 22.70% 77.10% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213478487 A -> G LOC_Os12g23750.1 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:16.669; most accessible tissue: Callus, score: 26.607 N N N N
vg1213478487 A -> G LOC_Os12g23750-LOC_Os12g23754 intergenic_region ; MODIFIER silent_mutation Average:16.669; most accessible tissue: Callus, score: 26.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213478487 2.02E-06 3.94E-10 mr1606 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213478487 NA 8.47E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213478487 NA 1.84E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213478487 NA 8.86E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213478487 NA 4.89E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251