Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213477382:

Variant ID: vg1213477382 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13477382
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAATACTATCGCGACCATATTGGTAATAATTAAATTTAAGTGCGATGGAATAAGAATTAGCCCTAATTAAAATTCAAATAAATTATATAAAAATAAA[A/G]
TATGGGTAATATTAATCTAGGGTGAATCCATTGGTTGAAATAACACAAATATTGAGTAAACTTCATTTGTGCAAAAATTAGGATTTATAGAATAGAATTT

Reverse complement sequence

AAATTCTATTCTATAAATCCTAATTTTTGCACAAATGAAGTTTACTCAATATTTGTGTTATTTCAACCAATGGATTCACCCTAGATTAATATTACCCATA[T/C]
TTTATTTTTATATAATTTATTTGAATTTTAATTAGGGCTAATTCTTATTCCATCGCACTTAAATTTAATTATTACCAATATGGTCGCGATAGTATTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	19.00%	1.16%	0.68%	NA
All Indica	2759	82.40%	16.30%	0.72%	0.58%	NA
All Japonica	1512	85.60%	12.00%	1.39%	0.99%	NA
Aus	269	26.00%	70.30%	3.72%	0.00%	NA
Indica I	595	87.10%	11.60%	1.01%	0.34%	NA
Indica II	465	92.70%	5.40%	0.43%	1.51%	NA
Indica III	913	80.10%	19.40%	0.44%	0.11%	NA
Indica Intermediate	786	75.60%	22.60%	1.02%	0.76%	NA
Temperate Japonica	767	91.70%	3.80%	2.74%	1.83%	NA
Tropical Japonica	504	85.50%	14.30%	0.00%	0.20%	NA
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	39.60%	60.40%	0.00%	0.00%	NA
Intermediate	90	71.10%	23.30%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213477382	A -> DEL	N	N	silent_mutation	Average:33.975; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1213477382	A -> G	LOC_Os12g23750.1	downstream_gene_variant ; 779.0bp to feature; MODIFIER	silent_mutation	Average:33.975; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1213477382	A -> G	LOC_Os12g23750-LOC_Os12g23754	intergenic_region ; MODIFIER	silent_mutation	Average:33.975; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213477382	NA	4.57E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	2.05E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	1.08E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	8.25E-06	mr1552	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	9.67E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	5.90E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	8.72E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	9.85E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213477382	NA	6.30E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251