\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213459961:

Variant ID: vg1213459961 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13459961
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAATGAGTTACGTGAGAAGCATACTCACTAAGCACATGAACCCCCAAGCTTTTCTATGTGCATGAATTACATAGGATCTATGAACTAAATCATGTGGA[A/G]
GTCTTGCAGATTTGTCCACTAACTCATTATTGACATCTTCTCTTGAATAGGTATGCTCGAGAAATCGGAATAATGAGACTTAGATAAATGCAAAATTCAG

Reverse complement sequence

CTGAATTTTGCATTTATCTAAGTCTCATTATTCCGATTTCTCGAGCATACCTATTCAAGAGAAGATGTCAATAATGAGTTAGTGGACAAATCTGCAAGAC[T/C]
TCCACATGATTTAGTTCATAGATCCTATGTAATTCATGCACATAGAAAAGCTTGGGGGTTCATGTGCTTAGTGAGTATGCTTCTCACGTAACTCATTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.30% 27.20% 5.37% 39.15% NA
All Indica  2759 13.90% 44.80% 4.02% 37.30% NA
All Japonica  1512 51.70% 1.70% 7.80% 38.76% NA
Aus  269 24.20% 1.50% 6.32% 68.03% NA
Indica I  595 10.40% 35.00% 2.35% 52.27% NA
Indica II  465 18.90% 38.30% 5.16% 37.63% NA
Indica III  913 11.30% 57.30% 4.71% 26.73% NA
Indica Intermediate  786 16.70% 41.50% 3.82% 38.04% NA
Temperate Japonica  767 80.30% 1.00% 1.56% 17.08% NA
Tropical Japonica  504 17.30% 3.60% 17.06% 62.10% NA
Japonica Intermediate  241 32.80% 0.00% 8.30% 58.92% NA
VI/Aromatic  96 65.60% 3.10% 3.12% 28.12% NA
Intermediate  90 46.70% 20.00% 5.56% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213459961 A -> DEL N N silent_mutation Average:14.152; most accessible tissue: Callus, score: 41.076 N N N N
vg1213459961 A -> G LOC_Os12g23720.1 upstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:14.152; most accessible tissue: Callus, score: 41.076 N N N N
vg1213459961 A -> G LOC_Os12g23730.1 downstream_gene_variant ; 3128.0bp to feature; MODIFIER silent_mutation Average:14.152; most accessible tissue: Callus, score: 41.076 N N N N
vg1213459961 A -> G LOC_Os12g23720-LOC_Os12g23730 intergenic_region ; MODIFIER silent_mutation Average:14.152; most accessible tissue: Callus, score: 41.076 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213459961 NA 1.37E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 9.61E-06 9.60E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 5.92E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.36E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 9.11E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.90E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.39E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.79E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 6.80E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.04E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.93E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 4.17E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.08E-12 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 3.01E-06 NA mr1836 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.62E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.61E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 2.20E-06 NA mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.81E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 8.94E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 7.99E-06 2.93E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.67E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 7.40E-09 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.76E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 4.32E-09 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 5.59E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 1.20E-07 NA mr1362_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.36E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.46E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.45E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 2.18E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.32E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.48E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 4.52E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.72E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 6.88E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 8.80E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.27E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 3.23E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 8.86E-07 8.86E-07 mr1852_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.23E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 8.58E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 7.05E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213459961 NA 1.31E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251