Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1213458686:

Variant ID: vg1213458686 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13458686
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGGAAACCTTTTACGGAGATAGTTATGAAACCTAAATTCCTTGACAAATAAGAATTATTTCCAGTCATTTAGGGGGGAGAGAATGAACCCCTAGATAG[G/A]
AAATGTCAGGAAATATGATAGTCCGGGACTAATGCATGTTACACCGTACTAGTGAATGCAGTTTGCATAAAGAATTAAAACTGCCAAACCACTTTGTAAA

Reverse complement sequence

TTTACAAAGTGGTTTGGCAGTTTTAATTCTTTATGCAAACTGCATTCACTAGTACGGTGTAACATGCATTAGTCCCGGACTATCATATTTCCTGACATTT[C/T]
CTATCTAGGGGTTCATTCTCTCCCCCCTAAATGACTGGAAATAATTCTTATTTGTCAAGGAATTTAGGTTTCATAACTATCTCCGTAAAAGGTTTCCGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	18.50%	14.88%	39.21%	NA
All Indica	2759	45.00%	5.00%	10.98%	39.04%	NA
All Japonica	1512	1.90%	45.80%	13.62%	38.69%	NA
Aus	269	1.50%	1.90%	49.44%	47.21%	NA
Indica I	595	34.80%	3.20%	11.60%	50.42%	NA
Indica II	465	38.70%	6.90%	7.96%	46.45%	NA
Indica III	913	57.40%	4.40%	10.62%	27.60%	NA
Indica Intermediate	786	42.00%	6.00%	12.72%	39.31%	NA
Temperate Japonica	767	1.20%	79.10%	1.96%	17.73%	NA
Tropical Japonica	504	3.80%	4.40%	29.76%	62.10%	NA
Japonica Intermediate	241	0.40%	26.10%	17.01%	56.43%	NA
VI/Aromatic	96	4.20%	7.30%	48.96%	39.58%	NA
Intermediate	90	21.10%	34.40%	15.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213458686	G -> DEL	N	N	silent_mutation	Average:16.775; most accessible tissue: Callus, score: 27.722	N	N	N	N
vg1213458686	G -> A	LOC_Os12g23720.1	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:16.775; most accessible tissue: Callus, score: 27.722	N	N	N	N
vg1213458686	G -> A	LOC_Os12g23730.1	downstream_gene_variant ; 4403.0bp to feature; MODIFIER	silent_mutation	Average:16.775; most accessible tissue: Callus, score: 27.722	N	N	N	N
vg1213458686	G -> A	LOC_Os12g23720-LOC_Os12g23730	intergenic_region ; MODIFIER	silent_mutation	Average:16.775; most accessible tissue: Callus, score: 27.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213458686	NA	7.71E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	NA	2.33E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	NA	4.33E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	2.83E-06	4.79E-14	mr1425	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	6.78E-06	2.62E-11	mr1425	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	NA	1.42E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213458686	NA	3.53E-08	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251