Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213438607:

Variant ID: vg1213438607 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13438607
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCCTGAATGTAGATTATTTCTGGTTTGTGCTCTAATAGTGTTGACAGCACTAGTTCTCTCTTATCTTTGTCACCAAGTCCTCTTATATTCCAAGAAA[G/A,T]
GATTTTCATTGCGATTGTGCCGGGACTCTAGGGAAACATGCGGAAAAACAAAAAGAGGCCGGTCTGGTAGCCAAAAGAACCTCCTTGGGCCTTAGCATTC

Reverse complement sequence

GAATGCTAAGGCCCAAGGAGGTTCTTTTGGCTACCAGACCGGCCTCTTTTTGTTTTTCCGCATGTTTCCCTAGAGTCCCGGCACAATCGCAATGAAAATC[C/T,A]
TTTCTTGGAATATAAGAGGACTTGGTGACAAAGATAAGAGAGAACTAGTGCTGTCAACACTATTAGAGCACAAACCAGAAATAATCTACATTCAGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	10.50%	1.78%	0.00%	T: 0.11%
All Indica	2759	97.50%	1.80%	0.47%	0.00%	T: 0.18%
All Japonica	1512	67.00%	28.80%	4.23%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	89.20%	8.20%	2.58%	0.00%	NA
Indica III	913	99.20%	0.20%	0.00%	0.00%	T: 0.55%
Indica Intermediate	786	98.60%	1.30%	0.13%	0.00%	NA
Temperate Japonica	767	92.60%	3.10%	4.30%	0.00%	NA
Tropical Japonica	504	21.00%	74.20%	4.76%	0.00%	NA
Japonica Intermediate	241	81.70%	15.40%	2.90%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	90.00%	6.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213438607	G -> A	LOC_Os12g23680.1	upstream_gene_variant ; 2600.0bp to feature; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N
vg1213438607	G -> A	LOC_Os12g23690.1	upstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N
vg1213438607	G -> A	LOC_Os12g23680-LOC_Os12g23690	intergenic_region ; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N
vg1213438607	G -> T	LOC_Os12g23680.1	upstream_gene_variant ; 2600.0bp to feature; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N
vg1213438607	G -> T	LOC_Os12g23690.1	upstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N
vg1213438607	G -> T	LOC_Os12g23680-LOC_Os12g23690	intergenic_region ; MODIFIER	silent_mutation	Average:51.61; most accessible tissue: Callus, score: 72.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213438607	NA	5.20E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	7.45E-06	7.45E-06	mr1131	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	7.63E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	9.67E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	1.29E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	4.34E-07	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	7.51E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	4.73E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	8.37E-06	mr1633	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	3.02E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	2.26E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	6.43E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	1.47E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	8.57E-08	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	4.45E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	2.83E-06	2.83E-06	mr1727	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	1.68E-06	mr1731	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	6.26E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	1.36E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	2.88E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213438607	NA	3.73E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251