\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213425621:

Variant ID: vg1213425621 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13425621
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACAACCTGAGAAGAGGCCGATACGTATAGTAATAGCGGCTCTTGTGGGTGTGGTGAGGCCAAAACTGGTGGAGTAGTGAGAAGTTTCTTGAAATCTTC[A/G]
AAGGCTTTCTGTGCTTCGGGTCCCCACTGGAAATTTTCTGTTTTCTTTAACAGTTTGAAGAAGGGCATCCCCCTCTCGCCGAGTCGTGAGACAAACCGGC

Reverse complement sequence

GCCGGTTTGTCTCACGACTCGGCGAGAGGGGGATGCCCTTCTTCAAACTGTTAAAGAAAACAGAAAATTTCCAGTGGGGACCCGAAGCACAGAAAGCCTT[T/C]
GAAGATTTCAAGAAACTTCTCACTACTCCACCAGTTTTGGCCTCACCACACCCACAAGAGCCGCTATTACTATACGTATCGGCCTCTTCTCAGGTTGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.90% 0.10% 3.24% 65.74% NA
All Indica  2759 17.60% 0.20% 4.31% 77.89% NA
All Japonica  1512 50.10% 0.00% 0.99% 48.94% NA
Aus  269 54.30% 0.40% 4.46% 40.89% NA
Indica I  595 25.20% 0.00% 2.35% 72.44% NA
Indica II  465 15.30% 0.40% 5.59% 78.71% NA
Indica III  913 11.90% 0.10% 4.38% 83.57% NA
Indica Intermediate  786 19.80% 0.30% 4.96% 74.94% NA
Temperate Japonica  767 82.80% 0.00% 0.52% 16.69% NA
Tropical Japonica  504 8.70% 0.00% 1.19% 90.08% NA
Japonica Intermediate  241 32.40% 0.00% 2.07% 65.56% NA
VI/Aromatic  96 29.20% 0.00% 5.21% 65.62% NA
Intermediate  90 47.80% 0.00% 2.22% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213425621 A -> DEL N N silent_mutation Average:6.318; most accessible tissue: Callus, score: 17.286 N N N N
vg1213425621 A -> G LOC_Os12g23650.1 upstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:6.318; most accessible tissue: Callus, score: 17.286 N N N N
vg1213425621 A -> G LOC_Os12g23640.1 downstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:6.318; most accessible tissue: Callus, score: 17.286 N N N N
vg1213425621 A -> G LOC_Os12g23660.1 downstream_gene_variant ; 408.0bp to feature; MODIFIER silent_mutation Average:6.318; most accessible tissue: Callus, score: 17.286 N N N N
vg1213425621 A -> G LOC_Os12g23650-LOC_Os12g23660 intergenic_region ; MODIFIER silent_mutation Average:6.318; most accessible tissue: Callus, score: 17.286 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213425621 4.92E-06 4.92E-06 mr1279_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213425621 2.96E-06 2.96E-06 mr1473_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213425621 3.19E-06 3.19E-06 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213425621 NA 1.07E-07 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213425621 NA 1.48E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213425621 NA 2.51E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251